Logy), and a-smooth muscle actin (1A4,

Logy), and a-smooth muscle actin (1A4, 1516647 Dako).RT-PCR analysisYolk sacs were placed in Trizol (GibcoBRL) and processed following manufacturers protocol. In brief, tissues were homogenized and 200 mL of chloroform was added per 1 mL Trizol. Following centrifugation at 10,000 g for 15 minutes at 4uC, the upper phase was removed and 300 mL of 100 ethanol was added per 1 mL of Trizol. After 5 minutes incubation at room temperature, RNA was isolated by centrifugation at 2,000 g for 5 minutes at 4uC. RNA was then precipitated from the phenolethanol supernatant by 1.5 mL isopropyl alcohol per 1 mL Trizol. After 10 minutes incubation at room temperature, RNA was isolated and reverse transcription was performed as per manufacturers protocol (Qiagen). Negative control represents no template. PCR primers used were as follows: Neuropilin-1 For: GCAATAGCAAAAGAAGGTTT Rev: ACCATGCCCAACAATCCAGA STAT6 For: ATCCAGCTTCAGGCCCTGTC Rev: TCTATCTGTGAGGAGCCATC Prox1 For: ATGCCTGACCATGACAGC Rev: GGGAAGCTTTTGCTTGCG CyclinE2 For: AAAGCCAGCCACGATTTATGCCA Rev: AGCCCCAAGTAGGAGCCACAG VEGFR-3 For: CAACGAGCGTGGTGAGCCCT Rev: GGCGGTCATCCCACACCACC GAPDH For: CTGCACCACCAACTGCTTAG Rev: TCTCATCATACTTGGCAGGT qRT-PCR was performed using the SYBR-green amplification kit as per manufacturers instructions (Qiagen).Specificity of Vascular Reprogramming via ProxIn vitro conditioned media and co-culture experimentsArterial endothelial cells (AECs) previously characterized [21], transfected with or without Prox1 were incubated with conditioned media collected from bovine smooth muscle cell cultures (AG08504, Coriell Cell Repositories, Coriell Institute, USA) 24?48 hours prior to lysis and western analysis. Co-culture experiments involved mixing equal numbers of AEC+Prox1 or control AECs with bovine smooth muscle cells. Analysis of the resulting co-culture was performed after 24 hours. Transfection was by Lipofectamine 2000 (Invitrogen) and a standard transfection protocol was used. To compare the levels of Prox1 between non-mixed AEC/Prox1 and AEC/Prox1+SMC, Prox1 levels were normalized for AEC content. For quantifying AEC content in our mixed cultures, 10 ug/ml of Dil-Ac-LDL was incubated in cultures that contained AECs for two hours at 37uC. Cells were trypsinized and AECs counted by FACS to obtain an AEC:SMC ratio. Densitometry measurements of Prox1 were normalized for loading relative to b-actin. Using the calculated AEC:SMC ratio, this percentage was applied to the levels of Prox1 in order to obtain a compensated level of Prox1 in the mixed AEC:SMC cultures.embryos stained for Prox1 and SMA reveal that by this timepoint Prox1 is suppressed on the AZ-876 dorsal aorta. (A) However, Prox1 positive cells do migrate from the cardinal vein in double transgenic embryos and in greater numbers than in (B) control samples. Scale bar = 50 mm. CV: cardinal vein; DA: dorsal aorta. (TIF)Figure S3 VP16 is expressed on the jugular vein and dorsal aorta. (A) Expression of VP16, a surrogate marker for driver activity is not found on control E13.5 embryos but (B) is expressed on both the dorsal artery and jugular vein of double transgenics. Scale bar = 50 mm. JV: jugular vein; DA: dorsal aorta; LS: lymph sac. (TIF)Western analysisVenous and arterial endothelial cells used in this study have been previously characterized [21]. Cells were lysed in RIPA get 166518-60-1 buffer for 30 minutes on ice (10 mM NaH2PO4 pH7.5, 150 mM NaCl, 1 NP-40, 0.1 SDS, 1 Sodium Deoxycholate, 10 mM NaF, 2 mM EDTA, Protease Inhibitor cocktail.Logy), and a-smooth muscle actin (1A4, 1516647 Dako).RT-PCR analysisYolk sacs were placed in Trizol (GibcoBRL) and processed following manufacturers protocol. In brief, tissues were homogenized and 200 mL of chloroform was added per 1 mL Trizol. Following centrifugation at 10,000 g for 15 minutes at 4uC, the upper phase was removed and 300 mL of 100 ethanol was added per 1 mL of Trizol. After 5 minutes incubation at room temperature, RNA was isolated by centrifugation at 2,000 g for 5 minutes at 4uC. RNA was then precipitated from the phenolethanol supernatant by 1.5 mL isopropyl alcohol per 1 mL Trizol. After 10 minutes incubation at room temperature, RNA was isolated and reverse transcription was performed as per manufacturers protocol (Qiagen). Negative control represents no template. PCR primers used were as follows: Neuropilin-1 For: GCAATAGCAAAAGAAGGTTT Rev: ACCATGCCCAACAATCCAGA STAT6 For: ATCCAGCTTCAGGCCCTGTC Rev: TCTATCTGTGAGGAGCCATC Prox1 For: ATGCCTGACCATGACAGC Rev: GGGAAGCTTTTGCTTGCG CyclinE2 For: AAAGCCAGCCACGATTTATGCCA Rev: AGCCCCAAGTAGGAGCCACAG VEGFR-3 For: CAACGAGCGTGGTGAGCCCT Rev: GGCGGTCATCCCACACCACC GAPDH For: CTGCACCACCAACTGCTTAG Rev: TCTCATCATACTTGGCAGGT qRT-PCR was performed using the SYBR-green amplification kit as per manufacturers instructions (Qiagen).Specificity of Vascular Reprogramming via ProxIn vitro conditioned media and co-culture experimentsArterial endothelial cells (AECs) previously characterized [21], transfected with or without Prox1 were incubated with conditioned media collected from bovine smooth muscle cell cultures (AG08504, Coriell Cell Repositories, Coriell Institute, USA) 24?48 hours prior to lysis and western analysis. Co-culture experiments involved mixing equal numbers of AEC+Prox1 or control AECs with bovine smooth muscle cells. Analysis of the resulting co-culture was performed after 24 hours. Transfection was by Lipofectamine 2000 (Invitrogen) and a standard transfection protocol was used. To compare the levels of Prox1 between non-mixed AEC/Prox1 and AEC/Prox1+SMC, Prox1 levels were normalized for AEC content. For quantifying AEC content in our mixed cultures, 10 ug/ml of Dil-Ac-LDL was incubated in cultures that contained AECs for two hours at 37uC. Cells were trypsinized and AECs counted by FACS to obtain an AEC:SMC ratio. Densitometry measurements of Prox1 were normalized for loading relative to b-actin. Using the calculated AEC:SMC ratio, this percentage was applied to the levels of Prox1 in order to obtain a compensated level of Prox1 in the mixed AEC:SMC cultures.embryos stained for Prox1 and SMA reveal that by this timepoint Prox1 is suppressed on the dorsal aorta. (A) However, Prox1 positive cells do migrate from the cardinal vein in double transgenic embryos and in greater numbers than in (B) control samples. Scale bar = 50 mm. CV: cardinal vein; DA: dorsal aorta. (TIF)Figure S3 VP16 is expressed on the jugular vein and dorsal aorta. (A) Expression of VP16, a surrogate marker for driver activity is not found on control E13.5 embryos but (B) is expressed on both the dorsal artery and jugular vein of double transgenics. Scale bar = 50 mm. JV: jugular vein; DA: dorsal aorta; LS: lymph sac. (TIF)Western analysisVenous and arterial endothelial cells used in this study have been previously characterized [21]. Cells were lysed in RIPA buffer for 30 minutes on ice (10 mM NaH2PO4 pH7.5, 150 mM NaCl, 1 NP-40, 0.1 SDS, 1 Sodium Deoxycholate, 10 mM NaF, 2 mM EDTA, Protease Inhibitor cocktail.

Leave a Reply