Egradation; which might have been as a result of a more

Egradation; which might have been as a result of a more permeable cell membrane to the PAH hydrophobic molecules [11]. Diaz and his colleagues [13] recorded in their research that crude oil biodegradation was greater at lower salinity and decreased at salinities twice that of normal sea water (35 g/L) while Mycobacterium smegmatis have been observed to survive in cultures with salinity concentrations as high as 1 M NaCl [14]. The ocean and terrestrial environments are susceptible to PAH pollution from oil-drilling (on/off-shore), crude oil refining process and tanker spills; and industrial waste effluents. These polluted habitats have varying conditions of pH and salinity as a result of processes such as ocean acidification, soil acidification and industrial waste effluent treatments [15,16,17,18]. Bacterial bioremediation of these contaminated environments is feasible provided the applied bioremediation technology is compatible. The multiple findings of the various effects of pH and salinity concentrations have prompted a molecular research on geneRing-Cleavage Dioxygenase Genes in MycobacteriaTable 1. Primers used in qRT-PCR studies of pH and salinity changes- induced pyrene degradation and the reference genes of Mycobacterium gilvum PYR-GCK.Primer sequences Gene designation rrs rpoB rpoD dnaG phdF phdI pcaG pcaH Forward (59?9) GGCGTGCTTAACACATGCAA GTCATCGTCTGGTCACCCTG GTCGCTCCGGGACCACATCC TCACCACCGGCGTCCAGTCT GCACCACCTTCTGACCGTAA TGACGAAGTGATGGGTGCTC GGTGTCCTGCAGTTGGATGT Somatostatin-14 cost GTTGAGACTGGCGAACGGTA Reverse (59?9) GCATGCGGTCCTATTCGGTA AGGTCAACAAGAAGCTCGG TCAGGAGGTGTGCTTGGCCG CCCTGCTCGACGGGGGACAT TTGGGTTTGAGGTGGGAACC AGTGCCGTGTATTTCGTCGT TACATTCCCGGCAAGCAGTT AATGTTCAGCAAACGCGAGGinformation such as its genome annotations (http://jgi.doe.gov/) and expressed proteins as a result of pyrene induction. This has provided a foundation for further studies on the strain’s biodegradative activity in different environmental conditions; to give vital information on the development of future bioremediation applications.Materials and Methods Reagents and bacterial strain maintenanceMycobacterium gilvum PYR-GCK was acquired from the American Type Culture Collection under the code name Mycobacterium flavescens ATCC 700033. The strain was maintained in Bacto Brain Heart Infusion agar plates (BD Laboratories, Sparks, USA) at 29uC or stock preserved in same media (broth) supplemented with 28 glycerol at 80uC. The pyrene substrate (confirmed .98.0 pure by Aldrich Company) and other chemicals used wereGenes description and locus tag are as follows: Candidate endogenous control genes: rrs (16S RNA Bromopyruvic acid web ribosomal subunit: Mflv_ R0023), rpoB (DNAdirected RNA polymerase subunit: Mflv_5097), rpoD (RNA polymerase subunit, sigma-70 family: Mflv_4912), dnaG (Primase: Mflv_2722); Aromatic ringcleaving dioxygenase genes of interest: phdF (Extradiol dioxygenase: Mflv_ 0538), phdI (1-hydroxy-2-naphthoate dioxygenase/gentisate-1,2dioxygenase: Mflv_ 0589), pcaG (protocatechuate-3,4-dioxygenase, alpha subunit: Mflv_0529), pcaH (protocatechuate-3,4-dioxygenase, beta subunit: Mflv_ 0530). All primers were generated using Primer Express software (version 2.0). doi:10.1371/journal.pone.0058066.texpression, focusing on the activities of some key genes/enzymes in pyrene degradation as a result of acidification and different NaCl concentrations induction. An insight into the molecular adaptation of the mycobacterial strain to the various states of pH and salinity concentrations, during py.Egradation; which might have been as a result of a more permeable cell membrane to the PAH hydrophobic molecules [11]. Diaz and his colleagues [13] recorded in their research that crude oil biodegradation was greater at lower salinity and decreased at salinities twice that of normal sea water (35 g/L) while Mycobacterium smegmatis have been observed to survive in cultures with salinity concentrations as high as 1 M NaCl [14]. The ocean and terrestrial environments are susceptible to PAH pollution from oil-drilling (on/off-shore), crude oil refining process and tanker spills; and industrial waste effluents. These polluted habitats have varying conditions of pH and salinity as a result of processes such as ocean acidification, soil acidification and industrial waste effluent treatments [15,16,17,18]. Bacterial bioremediation of these contaminated environments is feasible provided the applied bioremediation technology is compatible. The multiple findings of the various effects of pH and salinity concentrations have prompted a molecular research on geneRing-Cleavage Dioxygenase Genes in MycobacteriaTable 1. Primers used in qRT-PCR studies of pH and salinity changes- induced pyrene degradation and the reference genes of Mycobacterium gilvum PYR-GCK.Primer sequences Gene designation rrs rpoB rpoD dnaG phdF phdI pcaG pcaH Forward (59?9) GGCGTGCTTAACACATGCAA GTCATCGTCTGGTCACCCTG GTCGCTCCGGGACCACATCC TCACCACCGGCGTCCAGTCT GCACCACCTTCTGACCGTAA TGACGAAGTGATGGGTGCTC GGTGTCCTGCAGTTGGATGT GTTGAGACTGGCGAACGGTA Reverse (59?9) GCATGCGGTCCTATTCGGTA AGGTCAACAAGAAGCTCGG TCAGGAGGTGTGCTTGGCCG CCCTGCTCGACGGGGGACAT TTGGGTTTGAGGTGGGAACC AGTGCCGTGTATTTCGTCGT TACATTCCCGGCAAGCAGTT AATGTTCAGCAAACGCGAGGinformation such as its genome annotations (http://jgi.doe.gov/) and expressed proteins as a result of pyrene induction. This has provided a foundation for further studies on the strain’s biodegradative activity in different environmental conditions; to give vital information on the development of future bioremediation applications.Materials and Methods Reagents and bacterial strain maintenanceMycobacterium gilvum PYR-GCK was acquired from the American Type Culture Collection under the code name Mycobacterium flavescens ATCC 700033. The strain was maintained in Bacto Brain Heart Infusion agar plates (BD Laboratories, Sparks, USA) at 29uC or stock preserved in same media (broth) supplemented with 28 glycerol at 80uC. The pyrene substrate (confirmed .98.0 pure by Aldrich Company) and other chemicals used wereGenes description and locus tag are as follows: Candidate endogenous control genes: rrs (16S RNA ribosomal subunit: Mflv_ R0023), rpoB (DNAdirected RNA polymerase subunit: Mflv_5097), rpoD (RNA polymerase subunit, sigma-70 family: Mflv_4912), dnaG (Primase: Mflv_2722); Aromatic ringcleaving dioxygenase genes of interest: phdF (Extradiol dioxygenase: Mflv_ 0538), phdI (1-hydroxy-2-naphthoate dioxygenase/gentisate-1,2dioxygenase: Mflv_ 0589), pcaG (protocatechuate-3,4-dioxygenase, alpha subunit: Mflv_0529), pcaH (protocatechuate-3,4-dioxygenase, beta subunit: Mflv_ 0530). All primers were generated using Primer Express software (version 2.0). doi:10.1371/journal.pone.0058066.texpression, focusing on the activities of some key genes/enzymes in pyrene degradation as a result of acidification and different NaCl concentrations induction. An insight into the molecular adaptation of the mycobacterial strain to the various states of pH and salinity concentrations, during py.