D. Additions were performed drop-wise with stirring, and then the solution

D. Additions were performed drop-wise with stirring, and then the solution, which remained clear, was incubated at 4uC for 10?2 h. This material was ultrafiltered using an Amicon YM10 membrane (Millipore) and the retentate (10?5 mL) was centrifuged (30,000 g/4uC/20 min) to remove the precipitate, if any. The soluble proteins were buffer GSK2126458 site exchanged into PBS (pH 7.4) by extensive dialysis.Protein Expression, SDS-PAGE and Western Blot AnalysisMeasurements of protein expression and solubility were performed essentially as described [4]. E. coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies) were used for all expression experiments unless otherwise specified. In vivo expression studies involving His6-MBP-GFP and GroEL/S were performed inThe Mechanism of Solubility Enhancement by MBPTable 1. Primer sequences.Passenger protein G3PDH Forw. G3PDH Rev. GFP Forw. GFP Rev. DHFR Forw. DHFR Rev. DUSP14 Forw. DUSP14 Rev. TEV purchase GSK2334470 protease Forw. TEV protease Rev.Sequence (5′ ?3′) GAGAACCTGTACTTCCAGGGTATGGTGAAGGTCGGTGTGAACGGATTTG GGGGACCACTTTGTACAAGAAAGCTGGGTTATTACTCCTTGGAGGCCATGTAGGCCATGAGG GAGAACCTGTACTTCCAGGGTGCTAGCAAAGGAGAAGAACTCTTC GGGGACCACTTTGTACAAGAAAGCTGGGTTATTATTTGTATAGTTCATCCATGCCA GAGAACCTGTACTTCCAGGGTATGGTTGGTTCGCTAAACTGCATCGTCGC GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCATTCTTCTCATATACTTCAAATTTG GAGAACCTGTACTTCCAGGGTATTTCCGAGGGTGACATCGGTGGCATTGCTCAAATCACC GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAGTGTCGGGACTCCTTCTCATAGAC GAGAACCTGTACTTCCAGCCGGAAAGCTTGTTTAAGGGGCCGCGTG GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAGCGACGGCGACGACGATTCATGdoi:10.1371/journal.pone.0049589.tThe concentration and total yield of the refolded fusion proteins were determined spectrophotometrically on the basis of their absorbance at 280 nm (A280 nm) and calculated extinction coefficients. However, because some preparations contained a significant amount of truncated polypeptides, fusion protein concentrations were also assessed by comparing the Commassie Blue staining intensity of serial dilutions with known quantities of BSA after SDS-PAGE (data not shown). The His6-MBP-DHFR and His6-MBP-G3PDH fusion proteins were also refolded in the presence of purified GroEL and GroES. The refolding buffer contained a 2-fold molar excess of GroES (1.2 mM) relative to GroEL (0.6 mM). The final concentration of the enzymes (G3PDH and DHFR) was kept at 0.3 mM. Refolding was initiated by the addition of ATP to 5 mM along with 10 mM MgCl2. The solution was mixed, and after 15 min at room temperature, enzyme activity was analyzed.CCD camera and Alpha Imager software (Alpha Innotech, San Leandro, CA). Fluorescence spectra for 1407003 GFP were measured with a spectrofluorometer FluoroMax-2 (Jobin Yvon HORIBA-SPEX, Edison, NJ). The concentration of GFP was 0.8 mM in all the fluorescence measurements. All 15857111 the measurements were made at 25uC using appropriate blanks for baseline correction of fluorescence intensity. The emission maximum at 508 nm was used for calculating relative units. In all of the above enzymatic assays, either commercially available pure enzymes from Sigma-Aldrich or ProSpec (East Brunswick, NJ) or crystallization-grade pure proteins that were produced in our laboratory were used as reference standards. Relative values were obtained by normalization against the reference standards. All chemicals used were of analytical grade.Results Enzyme Assays and GFP Fluorescence QuantitationThe enzymatic assays for the passenger proteins were conducted essentially as reported previously for G3PDH [31], DHFR [32],.D. Additions were performed drop-wise with stirring, and then the solution, which remained clear, was incubated at 4uC for 10?2 h. This material was ultrafiltered using an Amicon YM10 membrane (Millipore) and the retentate (10?5 mL) was centrifuged (30,000 g/4uC/20 min) to remove the precipitate, if any. The soluble proteins were buffer exchanged into PBS (pH 7.4) by extensive dialysis.Protein Expression, SDS-PAGE and Western Blot AnalysisMeasurements of protein expression and solubility were performed essentially as described [4]. E. coli BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies) were used for all expression experiments unless otherwise specified. In vivo expression studies involving His6-MBP-GFP and GroEL/S were performed inThe Mechanism of Solubility Enhancement by MBPTable 1. Primer sequences.Passenger protein G3PDH Forw. G3PDH Rev. GFP Forw. GFP Rev. DHFR Forw. DHFR Rev. DUSP14 Forw. DUSP14 Rev. TEV protease Forw. TEV protease Rev.Sequence (5′ ?3′) GAGAACCTGTACTTCCAGGGTATGGTGAAGGTCGGTGTGAACGGATTTG GGGGACCACTTTGTACAAGAAAGCTGGGTTATTACTCCTTGGAGGCCATGTAGGCCATGAGG GAGAACCTGTACTTCCAGGGTGCTAGCAAAGGAGAAGAACTCTTC GGGGACCACTTTGTACAAGAAAGCTGGGTTATTATTTGTATAGTTCATCCATGCCA GAGAACCTGTACTTCCAGGGTATGGTTGGTTCGCTAAACTGCATCGTCGC GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAATCATTCTTCTCATATACTTCAAATTTG GAGAACCTGTACTTCCAGGGTATTTCCGAGGGTGACATCGGTGGCATTGCTCAAATCACC GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAGTGTCGGGACTCCTTCTCATAGAC GAGAACCTGTACTTCCAGCCGGAAAGCTTGTTTAAGGGGCCGCGTG GGGGACCACTTTGTACAAGAAAGCTGGGTTATTAGCGACGGCGACGACGATTCATGdoi:10.1371/journal.pone.0049589.tThe concentration and total yield of the refolded fusion proteins were determined spectrophotometrically on the basis of their absorbance at 280 nm (A280 nm) and calculated extinction coefficients. However, because some preparations contained a significant amount of truncated polypeptides, fusion protein concentrations were also assessed by comparing the Commassie Blue staining intensity of serial dilutions with known quantities of BSA after SDS-PAGE (data not shown). The His6-MBP-DHFR and His6-MBP-G3PDH fusion proteins were also refolded in the presence of purified GroEL and GroES. The refolding buffer contained a 2-fold molar excess of GroES (1.2 mM) relative to GroEL (0.6 mM). The final concentration of the enzymes (G3PDH and DHFR) was kept at 0.3 mM. Refolding was initiated by the addition of ATP to 5 mM along with 10 mM MgCl2. The solution was mixed, and after 15 min at room temperature, enzyme activity was analyzed.CCD camera and Alpha Imager software (Alpha Innotech, San Leandro, CA). Fluorescence spectra for 1407003 GFP were measured with a spectrofluorometer FluoroMax-2 (Jobin Yvon HORIBA-SPEX, Edison, NJ). The concentration of GFP was 0.8 mM in all the fluorescence measurements. All 15857111 the measurements were made at 25uC using appropriate blanks for baseline correction of fluorescence intensity. The emission maximum at 508 nm was used for calculating relative units. In all of the above enzymatic assays, either commercially available pure enzymes from Sigma-Aldrich or ProSpec (East Brunswick, NJ) or crystallization-grade pure proteins that were produced in our laboratory were used as reference standards. Relative values were obtained by normalization against the reference standards. All chemicals used were of analytical grade.Results Enzyme Assays and GFP Fluorescence QuantitationThe enzymatic assays for the passenger proteins were conducted essentially as reported previously for G3PDH [31], DHFR [32],.