Onships between bFGF levels and the antiproliferation effect of paclitaxel (measuredOnships between bFGF levels and

Onships between bFGF levels and the antiproliferation effect of paclitaxel (measured
Onships between bFGF levels and the antiproliferation effect of paclitaxel (measured as EMAX and IC30) were analyzed using SAS. p-values indicate probability associated with r2. The 95 confidence interval (95 CI) around r2 is approximated as described previously [22].Antiproliferation effect of paclitaxel r2 EMAX Image Analysis Visual scoring IC30 Image Analysis Visual scoringRelationship between bFGF level and chemosensitivity p-value 95 CI around r0.208 0.094 0.317 0.< 0.0001 < 0.0001 < 0.0001 < 0.0.074?.370 ?0.011?.236 ?0.160?.478* 0.007?.222*?The r2 for image analysis showed a trend of being higher than the r2 for pathological scoring (p = 0.11). * The r2 for image analysis (0.317) were outside the 95 CI for pathological scoring (0.007?.222), indicating a statistically significant improvement in correlation using image analysis (p < 0.05).the antiproliferation effect of paclitaxel (Figures 3 and 4). No relationship was observed between bFGF levels and maximum apoptotic index (data not shown).Effects of tumor pathobiological parameters on the relationship between bFGF level and paclitaxel sensitivity The tumor pathobiological data of patient tumors were obtained from our previous report [20]. Analysis of the relationship between bFGF level and tumor sensitivity to the antiproliferation effect in tumor subgroups revealed significantly better correlations (i.e., higher r2 values) in stage III-IV, p53-positive and aFGF-negative tumors, and tumors with higher-than-median bFGF level (Figures 3 and 4), compared to low stage (I-II), p53-negative, aFGFpositive, and low bFGF tumors. The median bFGF level was 9.8 pg/mg protein. No differences were observed for the other pathobiological parameters (i.e., high or low grade, high or low levels of p-glycoprotein or Bcl-2).findings using the conventional, visual scoring method. However, while both methods yielded the same finding of an inverse correlation between bFGF level and tumor sensitivity PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28878015 to the antiproliferation effect of paclitaxel, the image analysis method provided more robust data and presented several additional advantages, as follows. The visual scoring method was semi-quantitative and based on the differential staining intensity at three different antibody concentrations. For example, a tumor AviptadilMedChemExpress Aviptadil showing no staining at the highest antibody concentration was scored as negative, a tumor showing positive staining at different antibody concentrations were scored as one, two or three pluses. In comparison, the current method required using a single antibody dilution, and, because the quantitative image analysis results were based on the results obtained from simultaneously stained standard curve samples, was not subjected to or affected by interday variability in staining intensity. Furthermore, the image analysis method applied the same analysis parameters to all samples and therefore minimized the potential operator bias. The image analysis method, by measuring bFGF levels in individual tumors, provided values for each of the 87 tumors. In comparison, the visual examination results provided readings of relative intensity which provided only 4 scores (negative and three scores of positive staining). This, in turn, enabled the analysis of the relationship between bFGF level and tumor sensitivity to the antiproliferation effect of paclitaxel in subgroups of tumors with different pathobiological properties; the results show better correlations in four pathobiological subgroups (late stages,.

Thy as an expected adverse event. Keywords: Achilles tendon, Mesenchymal stromal

Thy as an expected adverse event. Keywords: CyclopamineMedChemExpress Cyclopamine Achilles tendon, Mesenchymal stromal cells, OsteogenesisBackground Tendon pathologies are a common problem especially in people of working age. The tendon healing process includes the formation of a hematoma, the local infiltration of inflammatory cells, the release of cytokines and growth factors followed by the?2014 Machova Urdzikova et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Machova Urdzikova et al. BioMedical Engineering OnLine 2014, 13:42 http://www.biomedical-engineering-online.com/content/13/1/Page 2 offormation of new extracellular matrix, new blood vessels and finally maturation and organization of the tendon tissue. Various cell-based therapies have been used to treat tendon pathologies in several in vivo studies [1-3] and at least one clinical trial (OrthADAPT; ClinicalTrials.gov identifier NCT01687777). Clinically relevant cellbased therapies often utilize adult stem cells, e.g. multipotent mesenchymal stromal cells. Mesenchymal stromal cells of various origins have been implanted directly into a tendon injury or attached to biodegradable scaffolds used to repair the tendon; they have shown an apparent beneficial effect on the healing process [4] and migrated to the injured tendon [5]. It was repeatedly shown that the delivery of mesenchymal stromal cells can create an optimal environment to support tendon tissue regeneration via the formation of extracellular matrix, enhanced vascularization, the production of supporting factors, modulation of the immunoresponse and the replacement of damaged cells [4,6]. Our aim was to describe the effect of the xenogeneic transplantation of human multipotent mesenchymal stromal cells (hMSCs) prepared under Good Manufacturing Practice (GMP) conditions on the healing process of rat Achilles tendons and also to identify potential side effects of human mesenchymal cells (tumorigenesis, wrong differentiation pathways) transplanted into a tendon injury to confirm the safety of hMSC treatment.MethodsCell isolation and cultivationhMSCs were isolated from the bone marrow of healthy human donors. All procedures for hMSC preparation were performed under GMP in the spin-off company Bioinova, Ltd. (Prague, Czech Republic) and approved by the State Institute for Drug Control of the Czech Republic (SUKL, Czech Republic). The mononuclear fraction containing hMSCs was separated from the bone marrow by gradient centrifugation using 25 Gelofusine (B. Braun, Melsungen, Germany) and seeded on plastic dishes at a concentration of 5 ?10 ?106 cells/75 cm2. The cells were expanded in media containing Alpha MEM Eagle without Deoxyribonucleotides, Ribonucleotides and UltraGlutamin (Lonza, Basel, Switzerland) PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27362935 supplemented with 5 mixed allogeneic Ro4402257 site thrombocyte lysate (Bioinova, Prague, Czech Republic) and 10 g/ml Gentamicin (Lek Pharmaceuticals, Ljublanja, Slovenia); non-adherent cells were washed out by changing the medium. When the cells reached 80 confluence, they were detached from the surface of the dishes using 1 ml/75 cm2 o.Thy as an expected adverse event. Keywords: Achilles tendon, Mesenchymal stromal cells, OsteogenesisBackground Tendon pathologies are a common problem especially in people of working age. The tendon healing process includes the formation of a hematoma, the local infiltration of inflammatory cells, the release of cytokines and growth factors followed by the?2014 Machova Urdzikova et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.Machova Urdzikova et al. BioMedical Engineering OnLine 2014, 13:42 http://www.biomedical-engineering-online.com/content/13/1/Page 2 offormation of new extracellular matrix, new blood vessels and finally maturation and organization of the tendon tissue. Various cell-based therapies have been used to treat tendon pathologies in several in vivo studies [1-3] and at least one clinical trial (OrthADAPT; ClinicalTrials.gov identifier NCT01687777). Clinically relevant cellbased therapies often utilize adult stem cells, e.g. multipotent mesenchymal stromal cells. Mesenchymal stromal cells of various origins have been implanted directly into a tendon injury or attached to biodegradable scaffolds used to repair the tendon; they have shown an apparent beneficial effect on the healing process [4] and migrated to the injured tendon [5]. It was repeatedly shown that the delivery of mesenchymal stromal cells can create an optimal environment to support tendon tissue regeneration via the formation of extracellular matrix, enhanced vascularization, the production of supporting factors, modulation of the immunoresponse and the replacement of damaged cells [4,6]. Our aim was to describe the effect of the xenogeneic transplantation of human multipotent mesenchymal stromal cells (hMSCs) prepared under Good Manufacturing Practice (GMP) conditions on the healing process of rat Achilles tendons and also to identify potential side effects of human mesenchymal cells (tumorigenesis, wrong differentiation pathways) transplanted into a tendon injury to confirm the safety of hMSC treatment.MethodsCell isolation and cultivationhMSCs were isolated from the bone marrow of healthy human donors. All procedures for hMSC preparation were performed under GMP in the spin-off company Bioinova, Ltd. (Prague, Czech Republic) and approved by the State Institute for Drug Control of the Czech Republic (SUKL, Czech Republic). The mononuclear fraction containing hMSCs was separated from the bone marrow by gradient centrifugation using 25 Gelofusine (B. Braun, Melsungen, Germany) and seeded on plastic dishes at a concentration of 5 ?10 ?106 cells/75 cm2. The cells were expanded in media containing Alpha MEM Eagle without Deoxyribonucleotides, Ribonucleotides and UltraGlutamin (Lonza, Basel, Switzerland) PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27362935 supplemented with 5 mixed allogeneic thrombocyte lysate (Bioinova, Prague, Czech Republic) and 10 g/ml Gentamicin (Lek Pharmaceuticals, Ljublanja, Slovenia); non-adherent cells were washed out by changing the medium. When the cells reached 80 confluence, they were detached from the surface of the dishes using 1 ml/75 cm2 o.

Nia pestis KIM5 plasmid encoding murine toxin and capsular antigen. Infect

Nia pestis KIM5 plasmid encoding murine toxin and capsular antigen. Infect Immun 1998, 66(12):5731-5742. Hinnebusch BJ: The evolution of flea-borne transmission of Yersinia pestis. Yersinia Molecular and Cellular Biology Norfolk, U.K.: Horizon BioscienceCarniel EaH BJ 2004, 49-73. Perry RD, SB 202190 site Fetherston JD: Yersinia pestis tiologic agent of plague. Clin Microbiol Rev 1997, 10(1):35-66. Jarrett CO, Deak E, Isherwood KE, Oyston PC, Fischer ER, Whitney AR, Kobayashi SD, DeLeo FR, Hinnebusch BJ: Transmission of Yersinia pestis from an infectious biofilm in the flea vector. J Infect Dis 2004, 190(4):783-792. Perry RD, Bobrov AG, Kirillina O, Jones HA, Pedersen L, Abney J, Fetherston JD: Temperature regulation of the hemin storage (Hms+) phenotype of Yersinia pestis is posttranscriptional. J Bacteriol 2004, 186(6):1638-1647. Schaible UE, Kaufmann SH: Iron and microbial infection. Nat Rev Microbiol 2004, 2(12):946-953. Bearden SW, Fetherston JD, Perry RD: Genetic organization of the yersiniabactin biosynthetic region and construction of avirulent SIS3 web mutants in Yersinia pestis. Infect Immun 1997, 65(5):1659-1668. Fetherston JD, Bertolino VJ, Perry RD: YbtP and YbtQ: two ABC transporters required for iron uptake in Yersinia pestis. Mol Microbiol 1999, 32(2):289-299. Fetherston JD, Lillard JW PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28893839 Jr, Perry RD: Analysis of the pesticin receptor from Yersinia pestis: role in iron-deficient growth and possible regulation by its siderophore. J Bacteriol 1995, 177(7):1824-1833. Bearden SW, Perry RD: The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Mol Microbiol 1999, 32(2):403-414. Gong S, Bearden SW, Geoffroy VA, Fetherston JD, Perry RD: Characterization of the Yersinia pestis Yfu ABC inorganic iron transport system. Infect Immun 2001, 69(5):2829-2837. Kirillina O, Bobrov AG, Fetherston JD, Perry RD: Hierarchy of iron uptake systems: Yfu and Yiu are functional in Yersinia pestis. Infect Immun 2006, 74(11):6171-6178. Thompson JM, Jones HA, Perry RD: Molecular characterization of the hemin uptake locus (hmu) from Yersinia pestis and analysis of hmu mutants for hemin and hemoprotein utilization. Infect Immun 1999, 67(8):3879-3892. Perry RD, Mier I Jr, Fetherston JD: Roles of the Yfe and Feo transporters of Yersinia pestis in iron uptake and intracellular growth. Biometals 2007, 20(3-4):699-703. Perry RD, Fetherston JD: Iron and Heme Uptake Systems. Yersinia Molecular and Cellular Biology Norfolk, U.K.: Horizon BioscienceCarniel EaH BJ 2004, 257-283. Hantke K: Iron and metal regulation in bacteria. Curr Opin Microbiol 2001, 4(2):172-177. Gao H, Zhou D, Li Y, Guo Z, Han Y, Song Y, Zhai J, Du Z, Wang X, Lu J, et al: The iron-responsive Fur regulon in Yersinia pestis. J Bacteriol 2008, 190(8):3063-3075. de Lorenzo V, Perez-Mart J, Escolar L, Pesole G, Bertoni G: Mode of binding of the Fur protein to target DNA: negative regulation of ironcontrolled gene expression. Washington D.C.: ASM Press 2004. Gottesman S, McCullen CA, Guillier M, Vanderpool CK, Majdalani N, Benhammou J, Thompson KM, FitzGerald PC, Sowa NA, FitzGerald DJ: Small RNA regulators and the bacterial response to stress. Cold Spring Harb Symp Quant Biol 2006, 71:1-11. Masse E, Gottesman S: A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc Natl Acad Sci USA 2002, 99(7):4620-4625. Wilderman PJ, Sowa NA, FitzGerald DJ, FitzGerald PC, Gottesman S, Ochsner UA, Vasil ML: Identification of tandem dup.Nia pestis KIM5 plasmid encoding murine toxin and capsular antigen. Infect Immun 1998, 66(12):5731-5742. Hinnebusch BJ: The evolution of flea-borne transmission of Yersinia pestis. Yersinia Molecular and Cellular Biology Norfolk, U.K.: Horizon BioscienceCarniel EaH BJ 2004, 49-73. Perry RD, Fetherston JD: Yersinia pestis tiologic agent of plague. Clin Microbiol Rev 1997, 10(1):35-66. Jarrett CO, Deak E, Isherwood KE, Oyston PC, Fischer ER, Whitney AR, Kobayashi SD, DeLeo FR, Hinnebusch BJ: Transmission of Yersinia pestis from an infectious biofilm in the flea vector. J Infect Dis 2004, 190(4):783-792. Perry RD, Bobrov AG, Kirillina O, Jones HA, Pedersen L, Abney J, Fetherston JD: Temperature regulation of the hemin storage (Hms+) phenotype of Yersinia pestis is posttranscriptional. J Bacteriol 2004, 186(6):1638-1647. Schaible UE, Kaufmann SH: Iron and microbial infection. Nat Rev Microbiol 2004, 2(12):946-953. Bearden SW, Fetherston JD, Perry RD: Genetic organization of the yersiniabactin biosynthetic region and construction of avirulent mutants in Yersinia pestis. Infect Immun 1997, 65(5):1659-1668. Fetherston JD, Bertolino VJ, Perry RD: YbtP and YbtQ: two ABC transporters required for iron uptake in Yersinia pestis. Mol Microbiol 1999, 32(2):289-299. Fetherston JD, Lillard JW PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28893839 Jr, Perry RD: Analysis of the pesticin receptor from Yersinia pestis: role in iron-deficient growth and possible regulation by its siderophore. J Bacteriol 1995, 177(7):1824-1833. Bearden SW, Perry RD: The Yfe system of Yersinia pestis transports iron and manganese and is required for full virulence of plague. Mol Microbiol 1999, 32(2):403-414. Gong S, Bearden SW, Geoffroy VA, Fetherston JD, Perry RD: Characterization of the Yersinia pestis Yfu ABC inorganic iron transport system. Infect Immun 2001, 69(5):2829-2837. Kirillina O, Bobrov AG, Fetherston JD, Perry RD: Hierarchy of iron uptake systems: Yfu and Yiu are functional in Yersinia pestis. Infect Immun 2006, 74(11):6171-6178. Thompson JM, Jones HA, Perry RD: Molecular characterization of the hemin uptake locus (hmu) from Yersinia pestis and analysis of hmu mutants for hemin and hemoprotein utilization. Infect Immun 1999, 67(8):3879-3892. Perry RD, Mier I Jr, Fetherston JD: Roles of the Yfe and Feo transporters of Yersinia pestis in iron uptake and intracellular growth. Biometals 2007, 20(3-4):699-703. Perry RD, Fetherston JD: Iron and Heme Uptake Systems. Yersinia Molecular and Cellular Biology Norfolk, U.K.: Horizon BioscienceCarniel EaH BJ 2004, 257-283. Hantke K: Iron and metal regulation in bacteria. Curr Opin Microbiol 2001, 4(2):172-177. Gao H, Zhou D, Li Y, Guo Z, Han Y, Song Y, Zhai J, Du Z, Wang X, Lu J, et al: The iron-responsive Fur regulon in Yersinia pestis. J Bacteriol 2008, 190(8):3063-3075. de Lorenzo V, Perez-Mart J, Escolar L, Pesole G, Bertoni G: Mode of binding of the Fur protein to target DNA: negative regulation of ironcontrolled gene expression. Washington D.C.: ASM Press 2004. Gottesman S, McCullen CA, Guillier M, Vanderpool CK, Majdalani N, Benhammou J, Thompson KM, FitzGerald PC, Sowa NA, FitzGerald DJ: Small RNA regulators and the bacterial response to stress. Cold Spring Harb Symp Quant Biol 2006, 71:1-11. Masse E, Gottesman S: A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc Natl Acad Sci USA 2002, 99(7):4620-4625. Wilderman PJ, Sowa NA, FitzGerald DJ, FitzGerald PC, Gottesman S, Ochsner UA, Vasil ML: Identification of tandem dup.

Can be expressed as a product of mutation operators on anCan be expressed as a

Can be expressed as a product of mutation operators on an
Can be expressed as a product of mutation operators on an initial (extended) AZD-8055 manufacturer sequence state. For example, the indel history illustrated in panels a and b of Fig. 4 can be represented as a series ??^ ^ ^ ^ of indel events, M D ?; 3? M I ?; 2? M D ?; 3? M I ?; 1?, on the initial basic state sI (given above). Then, the final result of this indel history is expressed as: ^ ^ ^ ^ hsI jM D ?; 3 I ?; 2 D ?; 3 I ?; 1?. Figure 4c shows the MSA among the initial, intermediate and final sequence states. Figure 4d shows the resulting PWA between the initial and final sequence states. These new tools, the ancestry indices and the operator representation of mutations, will play essential roles in our theoretical development described below. In the SID models [21], each evolutionary process was expressed as a (time-recorded) trajectory of sequence states, each of which was represented by an array of residues (without ancestry assignments). In consequence, an instantaneous transition from a state to the next state was often expressed as a summation of multiple possible muta tions. (For example, the transition from ? ; A to 0 ^ ^ ? could result from either M D ?; 1?or M D ?; 2?). Ancestry indices help avoid such ambiguous channels byEzawa BMC Bioinformatics (2016) 17:Page 8 of^ Fig. 3 Operator representation of mutations. a A substitution operator, M S ?; T C ? The residues before and after the substitution are in boldface in blue ^ ^ and red, respectively. b An insertion operator, M I ?; 3? and a fill-in operator, F ?; ; A; C ? The inserted sites are shaded in cyan. (Note that “A” at the top ^ of the rightmost inserted column means the ancestry index of 10, not the residue state of A). c A deletion operator, M D ?; 4? The sites to be deleted are shaded in magenta. In this figure, the extended sequence states were used for illustration. The bra-vector below each array denotes the state. The extended state, s, is identical to that in Fig. 2b. Each vertical arrow indicates the action of the mutation operator beside it. Note that the first arguments of all operators and the second argument of the deletion operator specify positions along the sequence, and not ancestries (specified at the top of the sites)uniquely defining each instantaneous state-to-state transition as an action of a single mutation. (In the above ex ample, the former causes the transition from ??; 2 to ?? ??, and the latter yields the transition fromto ?? ??). This, in conjunction with the operator representation of mutations, enables us to shift the focus from the trajectory of sequence states to the history of mutations, especially indels. This shift of focus, as wellFig. 4 Example indel history and resulting alignments. a An example indel history in terms of the bra-vectors of sequence states and indel operators. b The graphical illustration of the history using basic sequence states. Each sequence state in panel a is horizontally aligned with its graphical representation in panel b. c The resulting MSA among the sequence states that the indel history went through. d The resulting PWA between the initial and final sequences. In both c and d, the bold italicized characters in the leftmost column are the suffixes indicating the sequence states in panel a. In panels b, c, and d, the number in each site (cell) represents its ancestry, but not necessarily its position PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28404814 along the sequence. The `A’ in the final sequence abbreviates 10. The same shading scheme as in Fig. 1 is used.

Dditional file 1: Figure S1. Comparison of all pairwise gene expression sets.Dditional file 1: Figure

Dditional file 1: Figure S1. Comparison of all pairwise gene expression sets.
Dditional file 1: Figure S1. Comparison of all pairwise gene expression sets. Figure S2. qPCR controls. Table S1. Cell-specific gene lists from Zhang et al. Table S2. Cell-specific gene lists from Zeisel et al. Table S3. Microglial gene lists from Hickman et al. Table S4. Gene Expression Assays. Table S5. Primary and secondary antibodies. Table S6. Transcripts differentially expressed with age. Table S7. PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/25432023 Pathway, regulator and function changes with aging. Table S8. Transcripts differentially expressed between sexes. Table S9. Pathway, regulator and function differences between sexes. Table S10. Sex difference pathways, processes, and regulators. (ZIP 1133 kb)Abbreviations BHMTC: Benjamini ochberg multiple testing correction; SNK: Student?Newman euls Acknowledgements The authors thank the Genome Sciences Facility at the Penn State Hershey College of Medicine for microarray and quantitative PCR assistance, Wendy Holtry for helping execute all perfusion protocols, Dr. Benjamin Barres for graciously providing the C1q IHC antibody, the Penn State Microscopy and Cytometry Facility–University Park, PA, and Byron Bluth for assistance with the figure preparation. The authors declare no financial conflicts of interest. Funding This work was supported by the Donald W. Reynolds Foundation, the National Institute on Aging (R01AG026607, P30AG050911, F31AG038285), National Eye Institute (R01EY021716, R21EY024520, T32EY023202), and Oklahoma Center for Advancement of Science and Technology (HR14-174). Availability of data and materials All data generated or analyzed during this study are included in this published article: additional files and raw sequencing data are available from the Gene Expression Omnibus (GEO) #GSE85084. Authors’ contributions CAM designed the studies with WMF and WES and in conjunction with BW, DRM, GVB, MD, MMF, and RMB who performed the animal studies and molecular and biochemical experiments. DRS, NH, and WMF performed bioinformatic analyses. CAM and WMF wrote the manuscript with editing from all other authors. All authors read and approved the final manuscript. Ethics approval Animal studies were conducted with approval of the Penn State University Institutional Animal Use Committee. Consent for publication Not applicableReferences 1. Kennedy BK, Berger SL, Brunet A, Campisi J, Cuervo AM, Epel ES, Franceschi C, Lithgow GJ, Morimoto RI, Pessin JE, et al. Geroscience: linking aging to chronic disease. Cell. 2014;159(4):709?3. 2. Berchtold NC, Cribbs DH, Coleman PD, Rogers J, Head E, Kim R, Beach T, CEP-37440 site Miller C, Troncoso J, Trojanowski JQ, et al. Gene expression changes in the course of normal brain aging are sexually dimorphic. Proc Natl Acad Sci U S A. 2008;105(40):15605?0. 3. Blalock EM, Grondin R, Chen KC, Thibault O, Thibault V, Pandya JD, Dowling A, Zhang Z, Sullivan P, Porter NM, et al. Aging-related gene expression in hippocampus proper compared with dentate gyrus is selectively associated with metabolic syndrome variables in rhesus monkeys. J Neurosci. 2010; 30(17):6058?1. 4. Kadish I, Thibault O, Blalock EM, Chen KC, Gant JC, Porter NM, Landfield PW. Hippocampal and cognitive aging across the lifespan: a bioenergetic shift precedes and increased cholesterol trafficking parallels memory impairment. J Neurosci. 2009;29(6):1805?6. 5. Masser DR, Bixler GV, Brucklacher RM, Yan H, Giles CB, Wren JD, Sonntag WE, Freeman WM. Hippocampal subregions exhibit both distinct and shared transcriptomic responses to aging and nonneurodege.

E prognosis in Chinese gastric cancer. Int J Clin Exp Pathol.E prognosis in Chinese gastric

E prognosis in Chinese gastric cancer. Int J Clin Exp Pathol.
E prognosis in Chinese gastric cancer. Int J Clin Exp Pathol. 2015;8(8):9264?1. 61. He X, Lin X, Cai M, PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28154141 Zheng X, Lian L, Fan D, Wu X, Lan P, Wang J. Overexpression of order Peficitinib hexokinase 1 as a poor prognosticator in human colorectal cancer. Tumour Biol. 2016;37(3):3887?5. 62. Hooft L, van der Veldt AA, van Diest PJ, Hoekstra OS, Berkhof J, Teule GJ. Molthoff CF: [18 F]fluorodeoxyglucose uptake in recurrent thyroid cancer is related to hexokinase i expression in the primary tumor. J Clin Endocrinol Metab. 2005;90(1):328?4.Submit your next manuscript to BioMed Central and we will help you at every step:?We accept pre-submission inquiries ?Our selector tool helps you to find the most relevant journal ?We provide round the clock customer support ?Convenient online submission ?Thorough peer review ?Inclusion in PubMed and all major indexing services ?Maximum visibility for your research Submit your manuscript at www.biomedcentral.com/submit
Siddaramappa et al. BMC Genomics 2011, 12:570 http://www.biomedcentral.com/1471-2164/12/RESEARCH ARTICLEOpen AccessHorizontal gene transfer in Histophilus somni and its role in the evolution of pathogenic strain 2336, as determined by comparative genomic analysesShivakumara Siddaramappa1,2, Jean F Challacombe2, Alison J Duncan1, Allison F Gillaspy3, Matthew Carson3, Jenny Gipson3, Joshua Orvis3, Jeremy Zaitshik3, Gentry Barnes3, David Bruce2, Olga Chertkov2, J Chris Detter2, Cliff S Han2, Roxanne Tapia2, Linda S Thompson2, David W Dyer3 and Thomas J Inzana1*AbstractBackground: Pneumonia and myocarditis are the most commonly reported diseases due to Histophilus somni, an opportunistic pathogen of the reproductive and respiratory tracts of cattle. Thus far only a few genes involved in metabolic and virulence functions have been identified and characterized in H. somni using traditional methods. Analyses of the genome sequences of several Pasteurellaceae species have provided insights into their biology and evolution. In view of the economic and ecological importance of H. somni, the genome sequence of pneumonia strain 2336 has been determined and compared to that of commensal strain 129Pt and other members of the Pasteurellaceae. Results: The chromosome of strain 2336 (2,263,857 bp) contained 1,980 protein coding genes, whereas the chromosome of strain 129Pt (2,007,700 bp) contained only 1,792 protein coding genes. Although the chromosomes of the two strains differ in size, their average GC content, gene density (total number of genes predicted on the chromosome), and percentage of sequence (number of genes) that encodes proteins were similar. The chromosomes of these strains also contained a number of discrete prophage regions and genomic islands. One of the genomic islands in strain 2336 contained genes putatively involved in copper, zinc, and tetracycline resistance. Using the genome sequence data and comparative analyses with other members of the Pasteurellaceae, several H. somni genes that may encode proteins involved in virulence (e.g., filamentous haemaggutinins, adhesins, and polysaccharide biosynthesis/modification enzymes) were identified. The two strains contained a total of 17 ORFs that encode putative glycosyltransferases and some of these ORFs had characteristic simple sequence repeats within them. Most of the genes/loci common to both the strains were located in different regions of the two chromosomes and occurred in opposite orientations, indicating genome rearrangement since their divergence from a.

All tophi with CR. Results: Among 212 patients randomized in the RCTsAll tophi with CR.

All tophi with CR. Results: Among 212 patients randomized in the RCTs
All tophi with CR. Results: Among 212 patients randomized in the RCTs, 155 (73 ) had 1 tophus and 547 visible tophi were recorded at baseline. Overall tophus CR was recorded in 45 of patients in the biweekly group (P = 0.002 versus placebo), 26 in the monthly group, and 8 in the placebo group after six months of RCT therapy. TT-CR rates at six months were 28 , 19 , and 2 of tophi, respectively. Patients meeting the primary endpoint of sustained urate-lowering response to therapy (responders) were more likely than nonresponders to have an overall tophus CR at six months (54 vs 20 , respectively and 8 with placebo). Both overall tophus CR and TT-CRs increased with treatment duration in the OLE, reaching 70 (39/56) of patients and 55 (132/238) of target tophi after one year of treatment in patients receiving pegloticase during both the RCTs and OLE. At that time point, more tophi had resolved in responders (102/145 or 70 of tophi) than nonresponders (30/93; 32 ). Conclusions: Pegloticase reduced tophus burden in patients with refractory tophaceous gout, especially those achieving sustained urate-lowering. Complete resolution of tophi occurred in some patients by 13 weeks and in others with longer-term therapy. Trial registrations: NCT00325195, NCT* Correspondence: [email protected] 1 Center for Rheumatology Bone Research, 2730 University Blvd West, Wheaton, MD 20902, USA Full list of author information is ZM241385 mechanism of action available at the end of the article?2013 Baraf et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Baraf et al. Arthritis Research Therapy 2013, 15:R137 http://arthritis-research.com/content/15/5/RPage 2 ofIntroduction Refractory gout refers to the condition of a population of patients with symptomatic gout in whom treatment has failed to maintain a serum uric acid (SUA) level less than 6 mg/dl with oral urate-lowering therapies (ULTs) and appropriate medical management [1,2]. Patients with refractory gout are at risk for progressive urate crystal deposition disease, characterized by frequent attacks of acute gouty arthritis, gouty arthropathy and enlarging tophi, which are often associated with chronic pain, impairment of physical function and compromised healthrelated quality of life [1,3,4]. The tophus, a cardinal feature of chronic gout, is a mass of urate crystals embedded in fibrous and inflammatory tissue. Tophi contribute to gouty joint destruction and deformity and may undergo acute or chronic ulceration, erode adjacent bone, cause pressure effects on surrounding tissues and organs, interfere with joint function or become infected [1,5-9]. Once established, tophi do not regress or resolve unless the extracellular urate saturation that supports urate crystal deposition (reflected by hyperuricemia or SUA in excess of 6.8 mg/dl) is reversed and subsaturating urate levels are maintained. Achievement and maintenance of SUA in a range less than 6.0 mg for months to years does, however, promote dissolution PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/25962748 of urate crystal deposits and prevent further crystal deposition in tissues [10]. Rates of resolution of tophaceous deposits appear to be dependent on the extent of urate-lowering [11,12]. Furthermore, tracking the course of tophus size or number over time during treatm.

Ssociated with these operons. As a result we identified two uncharacterizedSsociated with these operons. As

Ssociated with these operons. As a result we identified two uncharacterized
Ssociated with these operons. As a result we identified two uncharacterized superfamilies that tended to strongly co-occur with the mutagenic SOS operons across most major lineages of the bacterial tree (Figure 1 and Additional file 1; 25 and 65 of all their recovered gene neighborhood showed such associations). The first of these is typified by the Bacillus subtilis YoqW protein (gi: 384175670) and the E.coli protein YedK (gi: 49176171), and contains a globular domain of about 220-260 residues in length, which was previously described as containing a domain of unknown (DUF159) in the Pfam database [16]. The second of these codes for a protein prototyped by Geobacter sulfurreducens GSU0042 (gi: 39995153) and contains a previously unknown, small, globular domain approximately 80 residues in length. Iterative sequence profile searches with PSI-BLAST and hidden Markov model searches with HMMSEARCH using an alignment of different representatives of this domain showed that it was related to a conserved domain found in the ImuB family of proteins that occurs C-terminal to the family Y DNA polymerase domain. For instance, HMMSEARCH using a HMM derived from the small GSU0042-like proteins recovered the ImuB C-terminal domains with e-value 10-4-10-5. Likewise, a search initiated using the Syntrophomonas wolfei protein Swol_1669 (gi: 114567184) recovered the ImuB C-terminal domains in a PSI-BLAST search (e-value = 10-3-10-4; iteration 7). Accordingly, we named this conserved domain the ImuB-C (for ImuB C-terminal) domain.Aravind et al. Biology Direct 2013, 8:20 http://www.biology-direct.com/content/8/1/Page 3 ofFigure 1 Operons and contextual network graph of the SRAP and ImuB-C containing proteins. Genes are represented as arrows, with the arrow head pointing from the 5′ to the 3′ direction. Operons are labeled with the gi number of the SRAP or ImuB-C gene in the neighborhood followed by the species name. Standard names of encoded domains are used to label genes, the rest being MPep, metallopeptidase; ATPDL, ATP-dependent DNA ligase. In the network graph, genes are represented as nodes, and edges indicate the gene context with the arrow head pointing to the gene in the 3′ direction of the neighborhood. Edges depicting genes arranged in diverging directions are shown with circular ends. Pfam DUF4130 is a predicted mutagenesisrelated enzyme that is associated with the PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/27735993 BKT140 site SplB-like radical SAM photolyases and uracil DNA glycosylases, which might modify thymines.Contextual and sequence-structure analyses reveal the DUF159 domain to be a DNA-associated autopeptidaseTo better understand the role of the DUF159 proteins in the SOS response we carefully examined their gene contexts and found that they are encoded in at least threedistinct operonic contexts related to the SOS response (Figure 1): 1) as neighbors of the UmuC-UmuD gene dyad that code for subunits of the translesion DNA PolV; 2) Alongside two or more genes that constitute the widespread mutagenic gene cluster namely ImuB, ImuA, andAravind et al. Biology Direct 2013, 8:20 http://www.biology-direct.com/content/8/1/Page 4 ofDnaE2 [1,9,10]; 3) As part of an operon with DinB (coding for translesion Pol IV). Exemplars of this geneneighborhood might further include LexA [1] or genes for bacterial versions of the DNA end-binding Ku protein and the ATP-dependent DNA ligase [17] or in certain cases a DnaE paralog. Conserved gene-neighborhoods combining the DUF159 and Ku genes also code for two previous.

HichPage 9 of(page number not for citation purposes)BMC Cancer 2009, 9:httpHichPage 9 of(page number not

HichPage 9 of(page number not for citation purposes)BMC Cancer 2009, 9:http
HichPage 9 of(page number not for citation purposes)BMC Cancer 2009, 9:http://www.biomedcentral.com/1471-2407/9/ControlErlotinib (80mg/kg)MP470 (50mg/kg)Erlotinib+MP470 (80mg/kg+50mg/kg)Negative control, primary antibody is replaced by blocking solutionPI staining show nucleusFigure 8 tion in of MP470-Erlotinib Effects xenograft tissues combination on Akt phosphorylaEffects of MP470-Erlotinib combination on Akt phosphorylation in xenograft tissues. IHC analysis for Akt activity was performed on the tumors harvested at the end of the treatment of an LNCaP xenograft mouse model. Paraffin embedded sections were immuno-stained for expression of phosphorylated Akt (Ser473). Tumors from mice treated with the MP470-Erlotinib combination had a near complete Aprotinin web inhibition of Akt phosphorylation compared to control or individual therapies (200 ?.may contribute to the tumor suppression seen in an LNCaP xenograft mouse model. In addition, hormonerefractory prostate cancer is a major clinical obstacle as there are no drugs to halt its progression [3]. Previous studies have shown that PI3K/Akt activation is associated with prostate cancer progression from an androgendependent to an androgen-independent state [30]. In androgen-ablated LNCaP cells, PI3K/Akt activity is elevated and required for growth and survival [31] and inhibition can restore sensitivity to apoptosis induction [32]. In a mouse xenograft model of LNCaP, conditional Akt activation promotes tumor growth in castrated animals by enhanced cell proliferation and inhibition of apoptosis [28]. Thus, blockage of Akt activity should prove beneficial for hormone-refractory prostate cancer. Our experiments showed that the MP470-Erlotinib combination efficiently inhibited Akt activity in androgen-ablated LNCaP cells (Fig. 3B), suggesting that this combination may be a viable treatment modality in patients failing androgen blockade or can be administered with androgens in front-line therapy to prevent hormone refractory status. Except for the loss of PTEN function, PI3K/Akt signaling is often dysregulated in human cancer due to constitutive activation of receptor tyrosine kinases (RTKs) [41]. Of the known RTKs, activation of the HER family (HER1, 2 and 3) and the PDGFR family has been demonstrated to associate with prostate cancer progression [16,19]. In prostate cancer cell lines, HER family receptors are over-expressed [42,43] and inhibition with specific TKIs has shown antitumor effects in vitro and in vivo [44,45]. HER familymembers are also widely expressed in cancerous tissues of the prostate and significant over-expression is found in hormone-refractory prostate cancer and metastatic tissue compared to localized prostate cancer [46]. Hence, HER family receptors have become potential therapeutic targets in prostate cancer [47]. MP470, designed as an ATPcompetitive TKI was very effective in inhibiting tyrosine phosphorylation in LNCaP and NIH3T3 cells after pervanadate stimulation (Fig. 4A and 4B). Further, the MP470-Erlotinib combination completely inhibited tyrosine phosphorylation and p85 binding (Fig. 4C) as well as Akt activity. The RTK phospho-antibody assay identified the HER family (HER1, HER2 and HER3) in LNCaP cells as targeted by MP470 (Fig. 5A). Erlotinib or MP470 alone did not totally inhibit phosphorylation of the HER family. However, MP470-Erlotinib combination completely inhibited the phosphorylation of HER1, PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26104484 HER2 and HER3, the binding of PI3K regulatory subunit p85 to HER3 and d.

Lationships between them are identified (see Figure 2). Biological NEs correspond toLationships between them are

Lationships between them are identified (see Figure 2). Biological NEs correspond to
Lationships between them are identified (see Figure 2). Biological NEs correspond to classes such as genes, proteins, cell lines, species, compounds, phenotypes, diseases, etc. Named entity recognition (NER) refers to the problem of labelling both the location (start, end) and the semantic class/type PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26866270 of a NE in text, and normalisation refers to the process of mapping a NEFigure 2. An example of a text-mining pipeline. Given a sentence from a paper (A), named entities (NEs) are extracted (green for species entities, red for protein/gene entities, blue for relationship cues) (B); these entities are then normalised to a corresponding identifier scheme (C); and relationships between entities extracted (D). The final result in this case is a network which explicitly encodes the semantic relationships between NEs found in the sentence. Text taken from PMID:14613582.# HENRY STEWART PUBLICATIONS 1479 ?364. HUMAN GENOMICS. VOL 5. NO 1. 17 ?29 OCTOBERREVIEWHarmston, Filsell and Stumpfto a unique identifier (or set of identifiers). Following NER and normalisation it is useful to determine if a real relationship exists between two or more NEs, as well as the type of relationship. Simply identifying that NEs occur together in a contiguous block of text does hint at the existence of some form of relationship; however, this relationship may be completely speculative, or the text may state that a relationship between the NEs does not exist.14 In biological research papers, two entities can co-occur for many reasons, including functional, physical, syntenic and evolutionary relationships. The performance of TM systems is often evaluated using precision and recall metrics against manually curated gold standard corpora. Precision can be interpreted as the probability that a randomly selected result is a true positive and is calculated as the number of true positives obtained over the sum of true positives and false positives. Recall can be intuitively interpreted as the probability that a randomly selected positive result is correctly identified; it can be calculated as the number of true positives divided by the number of items that should be found (the sum of true positives and false negatives).NERBiology is a dynamic and ever-expanding research area. This means that there are millions of entity names in use, with new ones constantly being created (eg through genome annotation and drug development). Neologisms are prevalent in the literature; it has been jokingly commented: `Scientists would rather share each other’s underwear than use each other’s nomenclature’ (Keith Yamamoto). Biological NER thus tends to be more difficult than NER tasks in other domains (eg newswires) due to the variability of biological nomenclatures.15,16 A single gene can have many synonyms (eg P53, TP53 and TRP53 all refer to the same gene). Gene names are subject to morphological (eg transcription factor, transcriptional factor), orthographic (eg nuclear factor [NF] kappa B, NF kB), combinatorial (eg homologue of actin, actin homologue) and Ornipressin site inflectional variation (eg antibody, antibodies). The HUGO Gene Nomenclature committee (HGNC)was created with the aim of assigning a unique gene symbol to every gene; however, currently, not all genes have been assigned a name and there are still problems with gene names mentioned in the past literature. Gene names can overlap with other names relating to different entity types in the biological domain, as well as with words that are found i.

Ssion [39,40]. Our results indicate that around half of the BAY1217389MedChemExpress BAY1217389 tumors expressSsion [39,40].

Ssion [39,40]. Our results indicate that around half of the BAY1217389MedChemExpress BAY1217389 tumors express
Ssion [39,40]. Our results indicate that around half of the tumors express the PDGFR, PDGFR and PDGFA, in both tumor and stroma as shown in Figure 1. We found no expression of the B ligand in tumor samples, which was surprising as 5 out of 8 cervical cancer cell lines expressed this ligand. In addition, both ligands have been found expressed in a number of other tumor types [9]. Whether this feature is unique to primary cervical cancer tumors merits further study. Interestingly 78 of the primary tumors express either the alpha or beta receptor. This elevated frequency of expression and co-expression highly suggest autocrine and paracrine functioning in cervical cancer tumors. This high frequency of expression and co-expression also occurred in the cervical cancer cell lines studied. It has been shown that the sole expression of PDGF receptors correlates with known adverse prognostic factors such as axillary lymph node metastases in breast cancer [28]. However, in this study we found no correlation between any combination of PDGF members expression with neither clinical characteristics of patients nor survival (data not shown). This observation does not exclude the possible prognostic significance of these receptors in cervical cancer. We alsostudied the mutational status of the PDGFR, based on the identification of activating gene mutations within a subset of GISTs that lacked KIT gene mutation, and where constitutive phosphorylation of PDGFR was observed, and the corresponding PDGFR isoforms demonstrated ligand-independent kinase activity [29]. These observations have profound PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28381880 implications for the treatment of solid tumors with imatinib, as some of these mutations confer either sensitivity or resistance to this tyrosine kinase inhibitor [41]. This can be explained on the lack of differences in the activation of downstream signaling intermediates between KIT-mutant and PDGFR-mutant tumors, suggesting that mutant PDGFR provides oncogenic signals that parallel those of mutant KIT [29]. Our sequence results indicate that the cervical cancer cell lines and primary tumors analyzed showed a number of intronic and exonic variations, most of them previously unreported, (Tables 2 and 3). The mutation G>A in codon 571 leading to a Glu>Lys substitution found in three of the cell lines has not been reported; however, the deletion/substitution SPDGHE566-571R (already reported) involves codon 571 which corresponds to the juxtamembrane domain of the protein. The significance of this change in regard to imatinib sensitivity is unknown [42] but this deletion increases PDGFR activation in the presence of PDGFA [29] suggesting that the mutation that we found, could affect the PDGFR functioning. In an attempt to study the possible effect of this mutation on the protein, we used the simulation program PolyPhen [43] to predict whether this mutation, found in the cell lines, is likely to have biological meaning. The results indicate that the G>A at codon 571 of exon 12 is “bening”. It is clear however, that this is only a theoretical approximation hence; the meaning of changes found must be investigated in experimental systems [44]. Besides, most of the intronic changes that we found are located in the proximity of the exon boundaries, and their possible meaning has to be studied. Regarding the samples from patients, we found the silent mutation at codon 824 already reported, in 10 out of 17 patients (59 ). In the normal cervical samples, we found that 6 out.

Dditional file 1: Figure S1. Comparison of all pairwise gene expression sets.Dditional file 1: Figure

Dditional file 1: Figure S1. Comparison of all pairwise gene expression sets.
Dditional file 1: Figure S1. Comparison of all pairwise gene expression sets. Figure S2. qPCR controls. Table S1. Cell-specific gene lists from Zhang et al. Table S2. Cell-specific gene lists from Zeisel et al. Table S3. Microglial gene lists from Hickman et al. Table S4. Gene Expression Assays. Table S5. Primary and secondary antibodies. Table S6. Transcripts differentially expressed with age. Table S7. PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/25432023 Pathway, regulator and function changes with aging. Table S8. Transcripts differentially expressed between sexes. Table S9. Pathway, regulator and function differences between sexes. Table S10. Sex difference pathways, processes, and regulators. (ZIP 1133 kb)Abbreviations BHMTC: Benjamini ochberg multiple testing correction; SNK: Student?Newman euls Acknowledgements The authors thank the Genome Sciences Facility at the Penn State Hershey College of Medicine for microarray and quantitative PCR assistance, Wendy Holtry for helping execute all perfusion protocols, Dr. Benjamin Barres for graciously providing the C1q IHC antibody, the Penn State Microscopy and Cytometry Facility–University Park, PA, and Byron Bluth for assistance with the figure preparation. The authors declare no financial conflicts of interest. Funding This work was supported by the Donald W. Reynolds Foundation, the National Institute on Aging (R01AG026607, P30AG050911, F31AG038285), National Eye Institute (R01EY021716, R21EY024520, T32EY023202), and Oklahoma Center for Advancement of Science and Technology (HR14-174). Availability of data and materials All data generated or analyzed during this study are included in this published article: additional files and raw sequencing data are available from the Gene Expression Omnibus (GEO) #GSE85084. Authors’ contributions CAM designed the studies with WMF and WES and in conjunction with BW, DRM, GVB, MD, MMF, and RMB who performed the A-836339MedChemExpress A-836339 animal studies and molecular and biochemical experiments. DRS, NH, and WMF performed bioinformatic analyses. CAM and WMF wrote the manuscript with editing from all other authors. All authors read and approved the final manuscript. Ethics approval Animal studies were conducted with approval of the Penn State University Institutional Animal Use Committee. Consent for publication Not applicableReferences 1. Kennedy BK, Berger SL, Brunet A, Campisi J, Cuervo AM, Epel ES, Franceschi C, Lithgow GJ, Morimoto RI, Pessin JE, et al. Geroscience: linking aging to chronic disease. Cell. 2014;159(4):709?3. 2. Berchtold NC, Cribbs DH, Coleman PD, Rogers J, Head E, Kim R, Beach T, Miller C, Troncoso J, Trojanowski JQ, et al. Gene expression changes in the course of normal brain aging are sexually dimorphic. Proc Natl Acad Sci U S A. 2008;105(40):15605?0. 3. Blalock EM, Grondin R, Chen KC, Thibault O, Thibault V, Pandya JD, Dowling A, Zhang Z, Sullivan P, Porter NM, et al. Aging-related gene expression in hippocampus proper compared with dentate gyrus is selectively associated with metabolic syndrome variables in rhesus monkeys. J Neurosci. 2010; 30(17):6058?1. 4. Kadish I, Thibault O, Blalock EM, Chen KC, Gant JC, Porter NM, Landfield PW. Hippocampal and cognitive aging across the lifespan: a bioenergetic shift precedes and increased cholesterol trafficking parallels memory impairment. J Neurosci. 2009;29(6):1805?6. 5. Masser DR, Bixler GV, Brucklacher RM, Yan H, Giles CB, Wren JD, Sonntag WE, Freeman WM. Hippocampal subregions exhibit both distinct and shared transcriptomic responses to aging and nonneurodege.

E subject had a grade 2 glucose measurement of 8.05 mmol/L (144.9 mgE subject had

E subject had a grade 2 glucose measurement of 8.05 mmol/L (144.9 mg
E subject had a grade 2 glucose measurement of 8.05 mmol/L (144.9 mg/dL). This subject, on one prior measurement during period 2, day-1, had a grade 1 glucose elevation of 6.22 mmol/L (112 mg/dL) that occurred after he completed DCV dosing and before he received DTG. Attempts to contact him afterfollow-up for additional follow-up testing were unsuccessful, and he was considered lost to follow-up.Pharmacokinetics of DTGThe mean plasma concentration-time profiles of DTG after administration of DTG alone and in combination with DCV are presented in Fig. 1. Coadministration of DTG 50 mg once daily with DCV 60 mg once daily increased DTG AUC0-, Cmax, and C by 33, 29, and 45 , respectively, compared with DTG administered alone. Dolutegravir CL/F decreased by 25 , while the t1/2 increased by 17 when coadministered with DCV compared with DTG administered alone (Table 1).Pharmacokinetics of DCVThe plasma concentration-time profiles after administration of DCV alone and in combination with DTG are presented in Fig. 2. DCV exposure did not appear to be meaningfully affected by coadministration with DTG 50 mg once daily (Table 2). DCV AUC0-, decreased by 2.2 , Cmax increased by 3 , and C increased by 6 compared with DCV administered alone. DCV CL/F increased by 2 , while the t1/2 increased by 1.8 whenTable 1 Statistical comparison of DTG PK parameters when administered with and without DCVPlasma DTG PK parameter Geometric mean (CV ) DTG alone (treatment A) (N = 12) AUC0- (hr ?g/mL) Cmax (g/mL) C (g/mL) CL/F (L/hr) t1/2 (hr) 35.7 (34.7) 2.65 (32.0) 0.771 (41.3) 1.40 (34.7) 13.9 (32.8) DTG + DCV (treatment C) (N = 12) 47.3 (26.3) 3.43 (24.5) 1.11 (36.6) 1.06 (26.3) 16.2 (32.6) Geometric least-squares mean ratio (90 CI) DTG + DCV vs DTG alone PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/27488460 1.33 (1.11?.59) 1.29 (1.07?.57) 1.45 (1.25?.68) 0.753 (0.627?.905) 1.17 (1.01?.35)Abbreviations: AUC0- area under the concentration-time curve over the dosing interval, C Ixazomib citrate price concentration at the end of the dosing interval, CI confidence interval, CL/F apparent clearance following oral dosing, Cmax maximum observed concentration, DCV daclatasvir, DTG dolutegravir, PK pharmacokinetic, t1/2 terminal phase half-life Treatment A = DTG 50 mg once daily; treatment C = DTG 50 mg once daily plus DCV 60 mg once dailyRoss et al. BMC Infectious Diseases (2016) 16:Page 5 of10,000 Concentration ?SD, ng/mL1,100 DCV 60 mg q24h ?5 days PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28914615 DCV 60 mg q24h + DTG 50 mg q24h ?5 days 10 0 5 10 15 20 25 Planned relative time, hours post dosingFig. 2 Mean plasma concentration-time profiles of daclatasvir (DCV) administered with and without dolutegravir (DTG). Abbreviations: q24h, every 24 h; SD, standard deviationcoadministered with DTG compared with DCV administered alone.Discussion The results from this study demonstrated that plasma exposure of DCV did not appear to be meaningfully affected when coadministered with DTG as compared with DCV administered alone. This result is consistent with the preclinical findings for DCV and DTG. Daclatasvir is a substrate of cytochrome P450 (CYP) 3A4 and the transporter P-glycoprotein (P-gp) [8, 9]. In vitro, DTG demonstrates minimal or no direct inhibition of CYP isozymes or of P-gp; and DTG is not considered an inducer of CYP3A4 [13]. Coadministration of DTG with DCV increased DTG AUC0-, Cmax, and C by approximately 33, 29, and 45 , respectively, compared with DTG administered alone. Dolutegravir is metabolized primarily through UDPglucuronosyltransferase 1A1 with a minor component ( 10 ).

The aspirin treated and non-treated high risk groups, an overall advantageousThe aspirin treated and non-treated

The aspirin treated and non-treated high risk groups, an overall advantageous
The aspirin treated and non-treated high risk groups, an overall advantageous effect of aspirin preventing OHSS might be seen. We strongly advise, therefore, the use of low-dose aspirin to prevent OHSS or to reduce its severity in all cases associated with high risk of that severe complication of ovulation induction. The coordinated interplay between platelets and ovaries may be accomplished further by the brain-derived neurotrophic factor (BDNF) – Sigma-1 receptor ?Akt ?eNOSsystem. Down-regulation of the system has been proved to be a pathogenetic factor for depression, cardiovascular diseases, diabetes mellitus type 2 and for several components of metabolic syndrome. The activation of S ma-1R signaling has emerged as a link between these pathologies [36,37]. BDNF is mainly produced by the brain accounting for over 70 in the circulation. Additional BDNF sources are the vascular endothelium, smooth muscle cells and activated monocytes/lymphocytes. It readily crosses the blood rain barrier, circulates in the plasma and is taken up and stored in the platelets. Upon platelet activation/ clotting BDNF is released to the extracellular fluid and platelet derived serum BDNF closely correlates with that in the brain [38,39]. Importantly, positive correlation has been documented between BDNF and serotonin release [40,41]. BDNF and serotonin are assumed to act synergistically as serotonin secretion, turnover and signaling is regulated by BDNF, while serotonin in turn controls BDNF production [41]. BDNF and its receptors are widely Quinagolide (hydrochloride) site distributed in peripheral tissues and implicated in modulating ovarium function and diseases related to ovarium dysfunction. With this contention in line Sigma-1R stimulation with selective serotonin reuptake inhibitors (SSRI) in ovariectomized animals and in postmenopausal women improved depressive disorders and provided cardiovascular protection [42]. This beneficial effect of SSRI is achieved by increased conversion of the precursor proBDNF to mature BDNF and its enhanced secretion into the extracellular space [43]. Stimulation of Sigma-1R by ovarial steroids, dehydroepiandrosterone (DHEA) or pregnelolone (PREG) and/or by their sulfates (DHEAS, PREGS) resulted in similar protection in experimental or clinical settings [44]. Interestingly, there are marked cyclic variations in platelet BDNF levels during menstruation. In the second half of menstrual cycle endometrial cells produce substantial amount of BDNF which is taken up by the platelets. The reduced accumulation of endometrium-derived BDNF in the platelets may lead to clinical consequences as seen in menopausa [45]. In a most recent comprehensive review detailed analysis is presented on the importance of BDNF in the paracrine regulation of ovarian function [46]. BDNF has been PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/27766426 shown to stimulate the early and final stage of folliculogenesis, oocyte maturation and early embryonic development. In women undergoing IVF treatment it was present PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27385778 in the follicular fluid, and cumulus and granulosa cells were identified as its major source. Significant positive correlation was found between circulating estradiol and BDNF levels and its ovarian secretion could be enhanced with LH, FSH and hCG administration. It is to be noted that BDNF release by the platelets was notB is et al. Journal of Ovarian Research 2014, 7:55 http://www.ovarianresearch.com/content/7/1/Page 5 ofmentioned in this particular review, however accumulating evidences suggest that platelet-derived mediator.

Tion in any medium, provided the original work is properly cited.Tion in any medium, provided

Tion in any medium, provided the original work is properly cited.
Tion in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http:// creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Khattak et al. BMC Developmental Biology 2013, 13:17 http://www.biomedcentral.com/1471-213X/13/METHODOLOGY ARTICLEOpen AccessFoamy virus for efficient gene transfer in regeneration studiesShahryar Khattak1,2, Tatiana Sandoval-Guzm 1,2, Nicole Stanke2,3, Stephanie Protze1,2, Elly M Tanaka1,2* and Dirk Lindemann2,3*AbstractBackground: Molecular studies of appendage regeneration have been hindered by the lack of a stable and efficient means of transferring exogenous genes. We therefore sought an efficient integrating virus system that could be used to study limb and tail regeneration in salamanders. Results: We show that replication-deficient foamy virus (FV) vectors efficiently transduce cells in two different regeneration models in cell culture and in vivo. Injection of EGFP-expressing FV but not lentivirus vector particles into regenerating limbs and tail resulted in widespread expression that persisted throughout regeneration and reamputation pointing to the utility of FV for analyzing adult phenotypes in non-mammalian models. Furthermore, tissue specific transgene expression is achieved using FV vectors during limb regeneration. Conclusions: FV vectors are efficient mean of transferring genes into axolotl limb/tail and infection persists throughout regeneration and reamputation. This is a nontoxic method of delivering genes into axolotls in vivo/ in vitro and can potentially be applied to other salamander species. Keywords: Foamy virus, Regeneration, Salamander, in vivo gene transferBackground Limb regeneration of salamanders has fascinated scientists for several decades. Salamanders, Newts and Axolotls, are used as model animals in limb regeneration studies. Regeneration of missing structures is achieved by blastema, a pool of restricted progenitors that is formed after amputation [1]. Electroporation of DNA is the fastest and efficient method to introduce exogenous transgenes into salamander limb and spinal cord in vivo but this expression is lost during regeneration as the electroporated DNA is episomal [2]. Infection of cells both in cell culture and in vivo by modified LCZ696 chemical information viruses has been a powerful means of expressing exogenous genes in various experimental systems. For example, retroviral infection has been crucial for the molecular analysis of chicken limb development [3]. A* Correspondence: [email protected]; [email protected] de 1 Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstr 108, 01307 Dresden, Germany 2 DFG-Center for RegenerativeTherapies Dresden, Technische Universit Dresden, Fetscherstr. 105, 01307 Dresden, Germany Full list of author information is available at the end of the articlecorresponding molecular analysis of limb regeneration in salamanders has been limited due to a paucity in gene transduction methods. Vaccinia and adenovirus have been used in limb regeneration studies, but their toxicity and non-integration phenotype limits their effectiveness [4,5]. PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/25957400 Similarly, pseudotyped retroviruses have been used in cultured cells [5-7] and a recent report showing their use in PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26795252 vivo but the issue of viral silencing after second round of regeneration was not investigated [8]. We therefore sought a virus system that efficiently and st.

A family of polynucleotide cytidine deaminases (CDA) that play important rolesA family of polynucleotide cytidine

A family of polynucleotide cytidine deaminases (CDA) that play important roles
A family of polynucleotide cytidine deaminases (CDA) that play important roles in antiviral defence. Human APOBEC3G and 3F can block the replication of a wide array of exogenous retroelements, including retroviruses such as human immunodeficiency virus (HIV) and murine leukaemia virus (MLV) [1,2], and hepadnaviruses such as hepatitis B virus (HBV) [3,4]. Primate lentiviruses including HIV counter APOBEC3G and 3F via their Vif protein, which binds to and triggers the proteasomal degradation of these cellular antivirals. In the absence of Vif, APOBEC3G and -F arepackaged into retroviral particles, and lethally edit nascent viral reverse transcripts [1,2,5,6]. What tethers APOBEC proteins to GS-5816 cost virions has so far remained incompletely characterized. While some have invoked a role for the viral genomic RNA, more undisputed is the claimed importance of the nucleocapsid region of HIV-1 Gag and of yet unknown cellular RNAs in this process [7-14]. APOBEC family members can also act on endogenous substrates, notably retroelements. APOBEC3A, 3G and 3F can block the propagation of PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26080418 endogenous retroviruses such as intracisternal-A particles (IAP) [15,16] or MusD,Page 1 of(page number not for citation purposes)Retrovirology 2008, 5:http://www.retrovirology.com/content/5/1/and APOBEC3A, 3B and, to a lesser extent, 3C and 3F can inhibit LINE-1 (Long Interspersed Nuclear Element 1) retrotransposition [15,17-20]. Furthermore, APOBEC3A, APOBEC3B, APOBEC3C and APOBEC3G can prevent Alu retrotransposition, a process mediated in trans by the reverse transcriptase and integrase activities encoded by LINE [17,18]. Interestingly, APOBEC3G overexpression appears to recruit Alu RNAs into APOBEC3G-containing high molecular mass ribonucleoprotein complexes [21]. The Alu family of repetitive sequences is one of the most successful groups of mobile genetic elements, having multiplied to more than one million copies in the human genome in some 65 million years of primate evolution [22,23]. Interestingly, the emergence of Alu as major primate genome remodelers has coincided with the expansion of the APOBEC3 gene family long before the appearance of modern lentiviruses [24,25], and there is a striking evolutionary coincidence between the expansion of the APOBEC gene cluster and the abrupt drop in retrotransposon activity that took place in primates, compared with rodents [26]. While the functions of Alu repetitive elements remain largely unknown, sequence analyses indicate that they originated from the evolutionary conserved 7SL RNA gene [27]. This gene encodes for the approximately 300-nucleotide-long RNA moiety of the signal recognition particle (SRP), a cytoplasmic ribonucleoprotein complex that associates with ribosomes to mediate the translocation of nascent proteins into the endoplasmic reticulum [28]. Interestingly, 7SL RNA was amongst the first host RNAs detected in avian and murine retroviral particles [29,30] and is packaged in HIV-1 virions at ten thousand and seven fold molar excess over the actin mRNA and viral genomic RNA respectively [31]. A recent study points to 7SL RNA as a mediator of APOBEC3G packaging into HIV virions PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/27486068 [32]. The results of the present work rather support a model in which the interaction between 7SL RNA and APOBEC3G may shed light on APOBEC3G-mediated inhibition of Alu retrotransposition, but does not mediate the retroviral particle incorporation of the CDA.ing the human APOBEC3G cDNA. The resulting proteins correspond to the NP_004891 an.

This phase as the SIVmac239Opt infected animals (p = 0.0015 ANOVA).SIVmacThis phase as the SIVmac239Opt

This phase as the SIVmac239Opt infected animals (p = 0.0015 ANOVA).SIVmac
This phase as the SIVmac239Opt infected animals (p = 0.0015 ANOVA).SIVmac239OptXWe recently reported on a pool of molecularly tagged but TAPI-2 site otherwise isogenic variants of SIVmac239 wherein 2? synonymous changes were introduced into the integrase gene to generate genetically distinct but biologically equivalent versions of SIVmac239 [21]. These variants were designed to be combined into a “synthetic swarm” of sequence discriminable but biologically equivalent viruses that can be used to track independent infection events in viral transmission and dissemination; detailed analysis suggested that despite the introduction of only 2? synonymous mutations, two of the variants showed decreased replicative capacity relative to the others (21). We transferred these same molecular tags from the wild type SIVmac239 into the optimized SIVmac239Opt clone and compared replication capacities of each tagged clone. After sequence confirming PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26795252 that each individual clone had23 9w tabttFennessey et al. Retrovirology (2015) 12:Page 5 ofap27(pg/mL)10 6 10 5 10 4 10Opt WTvRNA copies/mL109 108 107 106 105 104 103time (days)101 100 0 20 40 60 80 100bp27(pg/mL)10 6 10 5 10 4 10Opt WTDays post infectionFigure 4 In vivo replication curves of SIVmac239Opt and wild type SIVmac239. Rhesus macaques were intrarectally infected with either SIVmac239Opt (green), or SIVmac239WT (pink). The average viral load of the macaques infected with SIVmac239WT is shown in red. One macaque infected with SIVmac239Opt rapidly progressed to AIDS and was euthanized at 87 days post infection.time (days)cp27(pg/mL)106 105 104Opt WTreduced replicative capacity of variants D and I, which were reported previously [21] was recapitulated in the optimized versions, confirming our previous report that these two genotypes, despite only three synonymous mutations, restrict viral replication.Primer binding site correctiontime (days)Figure 3 In vitro replication curves of SIVmac239Opt and SIVmac239WT. In vitro replication dynamics of SIVmac239Opt were determined by measuring p27 capsid content six times over 14 days post-infection in CD4+ T-cell enriched PBMCs from three SIVna e, Indian-origin rhesus macaques (a ). Wild type SIVmac239 is displayed in a solid line, and the SIVmac239Opt is displayed with a dashed line.only the reported mutations, each optimized clone was compared to the corresponding wild type clone for in vitro replication in SupT1-R5 cells (Figure 5). Similar to our in vitro replication curves in primary macaque cells, there were some cultures where the optimized virus significantly out performed wild type (clones A, B, H, I, and untagged with p values <0.05 for each clone), but overall, optimized clones were not statistically different from wild type clones (p = 0.377 ANOVA). Interestingly, theIn order to assess the relative fitness costs of each suboptimal nucleotide, wild type virus was grown in vitro on SupT1-R5 cells for 2 months and sampled at least weekly for sequence analysis of vRNA to identify mutants and selection of optimal nucleotides. By day 21, the PBS had completely changed to the optimal version but the Env and Pol mutations had not yet arisen. PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/29072704 While the Env mutation occurred at approximately week 10, the Pol mutations were not seen within the 2 months of this experiment. Although it is clear from published research that all four are suboptimal clones that will mutate to optimal nucleotides given sufficient time and viral replication [1, 6], the mutation with the great.

H fragment using the primer combinations PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28151467 shown in Table 2. Positive and negative

H fragment using the primer combinations PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28151467 shown in Table 2. Positive and negative controls (healthy donor PMNs) were included in each assay. Strict laboratory precautions were taken to avoid cross contamination. Specimens that had a clear amplification in each duplicate reaction were considered to be positive.Sequencing and phylogenetic analysisSequencher program 4.7 (Gene Code Corp., Ann Arbor, MI). The alignment of multiple sequences, including the reference sequences for Oxaliplatin chemical information subtypes A , F , J and K (http://hiv-web.lanl.gov), was performed using the CLUSTAL X program [30] and followed by manual editing using the BioEdit Sequence Alignment Editor program version 5.0.7 [31]. PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28549975 Gaps and ambiguous positions were removed from the final alignment. The phylogenetic relationships were determined by two methods: the neighbor-joining (NJ) algorithm of MEGA version 5.0 software [32] and maximum likelihood (ML) using PHYML v.2.4.4 [33]. For the NJ method, trees were constructed under the maximum composite likelihood substitution model and bootstrap re-sampling was carried out 1000 times. For the ML method, phylogentic trees were constructed using the GTR + I + G substitution model and a BIONJ starting tree. Heuristic tree searches under the ML optimality criterions were performed using the nearest-neighbor interchange (NNI) branch-swapping algorithm. The approximate likelihood ratio test (aLRT) based on a Shimodaira-Hasegawa-like procedure was used as a statistical test to calculate branch support. Trees were displayed using the MEGA v.5 package.Nucleotide sequence accession numbersThe sequences described here have been deposited (accession numbers pending)The amplified DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and directly sequenced using second-round primers and the PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems/ Perkin-Elmer, Foster City, CA) on an automated sequencer (ABI 3130, Applied Biosystems). After excluding the primer regions, each amplicon was assembled into a contiguous sequence alignment and edited with theResults Blood samples were obtained from 41 MSM study participants who had been previously characterized as being infected with HIV-1 subtype B virus (Figure 1) [27]. The median VL in this cohort was 4.3 ?104 copies/ml (range, <400-39.3 ?104). The median baseline CD4positive T cell count was 564 cells/mm3 (range, 198?2449 cells/mm3). The age of the subjects ranged from 18 to 56 years, and the median age was 30.6 years. All patients were treatment-naive at the time of sampleSoares de Oliveira et al. Virology Journal 2012, 9:223 http://www.virologyj.com/content/9/1/Page 4 ofFigure 1 Phylogenetic tree constructed using a maximumlikelihood method from partial pol region (1279 bp; nt 3822?5101 of HXB2) of 41 samples from MSM that have previously been determined to be infected with HIV-1 subtype B (indicated by black circles) and 37 HIV-1 reference sequences from the Los Alamos HIV-1 database representing 11 genetic subtypes. Samples that were identified in this study to host subclade F1 DNA are indicated with star symbol. For purposes of clarity, the tree was midpoint rooted. The approximate likelihood ratio test (aLRT) values of 90 are indicated at nodes. The scale bar represents 0.05 nucleotide substitutions per site.collection. The main characteristics of the study population are shown in Table 1. Before processing the patient samples, we wanted to deter.

Nist protocols include less flexible options in terms of cycle programmingNist protocols include less flexible

Nist protocols include less flexible options in terms of cycle programming
Nist protocols include less flexible options in terms of cycle programming and early studies suggesting a minor reduction in pregnancy rates per cycle [20,21]. Increasing flexibility of GnRH antagonist protocols can be achieved with oral contraceptives [20]. Pretreatment with oral contraceptives allows programming of cycles, whereby stimulation can be started during a 5-day interval following withdrawal of the oral contraceptive [22]. Use of oral contraceptives with a GnRH antagonist protocol and the pregnancy outcomes of GnRH antagonist protocols are discussed below.Pregnancy outcomes of GnRH antagonist protocolsDespite an initial trend toward a lower pregnancy rate with GnRH antagonists compared with agonists in a number of early randomized controlled studies, a metaanalysis by Kolibianakis et al. [23] and a review PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28499442 by TurKaspa and Ezcurra [24] found no significant difference in the probability of live birth rates with the use of either a GnRH agonist or antagonist protocol [23] (Table 1). In normal responders, the use of GnRH antagonist versus long GnRH agonist protocols was associated with a statistically significant reduction of OHSS, with no evidence of a difference in live birth rates [45]. GnRH antagonist protocols have been shown to result in better outcomes than GnRH agonists in patients with poor prognosis [52,53]. In a meta-analysis of six clinical trials comparing GnRH antagonist versus GnRH agonist protocols PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/25432023 in poor ovarian responders in IVF/intracytoplasmic sperm injection (ICSI) cycles Franco et al. [54] indicated no difference between GnRH antagonists and agonists with respect to cycle cancellation rate, number of mature oocytes, and clinical pregnancy rate per cycle initiated, per oocyte retrieval, and per embryo transfer. Al-Inany et al.Figure 1 Schematic presentation of the ganirelix treatment regimen.Copperman and Benadiva Reproductive Biology and Endocrinology 2013, 11:20 http://www.rbej.com/content/11/1/Page 3 ofTable 1 Results of meta-analyses of GnRH analogs among patients treated for IVF ?odds ratio of live birth rateGnRH antagonists Events RCTs included in Kolibianakis et al. [23] Albano 2001 [25] European 2000 [8] Olivennes 2000 [26] N American 2001 [27] Middle East 2001 [28] Akman 2001 [29] Hohmann 2003 [30] Martinez 2003 [31] Franco 2003 [32] Hwang 2004 [33] Sauer 2004 [34] Loutradis 2004 [35] Check 2004 [36] Xavier 2005 [37] Malmusi 2005 [38] Marci 2005 [39] Cheung 2005 [40] Barmat 2005 [41] Bahceci 2005 [42] Badrawi 2005 [15] Schmidt 2005 [43] Lee 2005 [44] Total (n = 22) RCTs included in Al-Inany et al. [45] All women Albano 2000 [25] Barmat 2005 [41] Heijnen 2007 [46] Hurine 2006 [47] Kim 2009 [48] Kurzawa 2008 [49] Lin 2006 [50] Marci 2005 [39] Ye 2009 [51] Subtotal (95 CI) Total events Heijnen 2007 [46] Lin 2006 [50] Subtotal (95 CI) Total events Heterogeneity: 2 = 0.32, df = 1 (P = 0.57) Test for Chloroquine (diphosphate) custom synthesis overall effect: Z = 0.66 (P = 0.51) 97 222 70 22 205 60 265 102 34 13 70 17 13 14 22 4 35 198 40 205 91 54 37 60 30 109 824 217 78 21 199 60 259 79.7 8.4 100.0 0.80 (0.54?.21) 1.08 (0.51?.27) 0.89 (0.62?.26) 19 17 78 17 8 18 21 0 39 95 40 199 91 28 37 60 30 111 691 13.5 7.3 33.0 8.8 5.1 7.1 8.4 0.3 16.6 100.0 0.83 (0.44?.55) 0.65 (0.26?.62) 0.80 (0.54?.21) 1.00 (0.47?.11) 0.79 (0.28?.22) 0.64 (0.25?.62) 1.08 (0.51?.27) 10.36 (0.53?01.45) 0.87 (0.50?.53) 0.86 (0.69?.08) 34 97 22 60 72 4 18 4 3 8 9 9 8 7 5 4 3 13 29 11 3 13 436 198 486 126 208 236 24 111 21 14 27 24 58 30 66 30 30 33 40 73 50 24.

F an ovulation triggering agent, human chorionic gonadotropin (hCG), versus aF an ovulation triggering agent,

F an ovulation triggering agent, human chorionic gonadotropin (hCG), versus a
F an ovulation triggering agent, human chorionic gonadotropin (hCG), versus a gonadotropin-releasing hormone agonist (GnRHa) on early embryo development in vitro using a time-lapse system. Methods: Retrospective analysis of a prospectively collected database. A total of 739 embryos from 152 infertile couples Varlitinib site undergoing intracytoplasmic sperm injection cycles. Interventions : Embryo culture in a time-lapse incubator (EmbryoScope, Vitrolife, G eborg, Sweden). Main Outcome Measures: Embryo morphokinetic parameters. Results: In the 152 women, 252 embryos were derived from GnRHa-triggered cycles compared with 487 embryos derived from hCG-triggered cycles. Time-lapse analysis revealed that embryos from cycles triggered by a GnRHa cleaved faster than embryos derived from hCG-triggered cycles. Conclusion: Triggering with a GnRHa in in vitro fertilization cycles affects embryo kinetics. Keywords: Agonist trigger, Oocyte, Embryo quality, Time lapse, MorphokineticBackground Embryo quality is one of the most important factors affecting the success of in vitro fertilization (IVF). Currently, embryo quality is determined using morphological evaluation methods, and in most circumstances the embryologist’s decision is the last step in choosing the embryo that is transferred to the patient. Although morphological evaluation has been the gold standard for many years, it is a subjective process with inter- and intra-observer variability [1]. It is also a static evaluation method, and some abnormalities cannot be detected PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/25112874 over the time interval involved in embryo evaluation. Time-lapse monitoring is a new technology that enables dynamic, more objective evaluation of embryos [2, 3]. The treatment protocol and duration and the type and dosage of drugs are clinician-dependent factors that might affect oocyte and embryo quality. Initially, IVF* Correspondence: [email protected] 1 Novafertil IVF Centre, Yeni Meram yolu No:75, Meram, Konya, Turkey Full list of author information is available at the end of the articletreatment was performed in a natural cycle; however, over the last 20 years many different treatment protocols have been used [4]. Gonadotropin-releasing hormone agonists (GnRHa) have long been used to inhibit premature luteinizing hormone (LH) release. In the last decade, however, a GnRH antagonist protocol has become preferred for pituitary desensitization worldwide, because it is a more patient friendly approach that also reduces the risk of ovarian hyperstimulation syndrome (OHSS) [5]. Another advantage of antagonist cycles is they enable the use of a GnRHa for triggering final oocyte maturation. There are some physiological differences between human chorionic gonadotropin (hCG) and GnRHa triggers. Unlike hCG triggering of final oocyte maturation, GnRHa triggering is a more physiological approach, eliciting a surge of gonadotropins similar to that of the natural mid-cycle surge [6]. The serum LH and follicle-stimulating hormone (FSH) levels rise after 4 and 12 h, respectively, and are elevated for 24?6 h. The amplitudes of the surge are similar to?2016 Gurbuz et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26100631 (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indic.

Opulations. Medication assisted therapy with methadone or buprenorphine in opioid treatmentOpulations. Medication assisted therapy with

Opulations. Medication assisted therapy with methadone or buprenorphine in opioid treatment
Opulations. Medication assisted therapy with methadone or buprenorphine in opioid treatment programs (OTPs) is effective treatment for opioid addiction, and entails frequent contact with patients that may facilitate DAART [5,6]. Based on developmental work at our center [7], we hypothesized that providing DAART to HIV-infected?2011 Mullen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Mullen et al. BMC Infectious Diseases 2011, 11:45 http://www.biomedcentral.com/1471-2334/11/Page 2 ofindividuals in OTPs would be effective and sustainable. To address this question we designed a randomized controlled trial of DAART compared with SAT. In this paper we describe the rationale, methods, and baseline characteristics of subjects enrolled in our study.MethodsDesignThe study is a randomized, non-blinded trial comparing DAART and SAT in HIV-infected participants who are receiving medication assisted treatment at 1 of 5 OTPs in Baltimore, Maryland. In the DAART intervention, study assistants observe PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/28494239 morning doses of antiretroviral therapy (ART) on weekdays when participants attend the OTP; other doses are self-administered. Participants in the control arm self-administer all doses. The primary outcome is viral load suppression, measured at 3, 6, and 12 months. We provide DAART for up to 12 months, after which participants assigned to this arm convert to self-administration. We follow participants to 18 months to assess the potential persistence of any benefits realized during the intervention period.Settingprotease inhibitor, non-nucleoside reverse transcriptase inhibitor, abacavir, or integrase inhibitor. Additionally, we required verbal agreement to participate from participants’ HIV medical providers. Exclusion criteria included stable ART use with HIV RNA < 500 copies/ mL, ART dosed more frequently than twice daily, use of liquid antiretroviral preparations, participation in another HIV adherence program in which medication is directly administered, or fewer than 1.5 `active' drugs in the specified regimen - as predicted by prior genotypic resistance tests (if available) and mutation interpretation guidelines [9].Participant RecruitmentWe enrolled participants from 5 OTPs in Baltimore between May 2006 and May 2010. Initially, the study began with three sites (1, 2, and 3). However, we discontinued recruitment at site 3 due to slow enrollment and replaced it with sites 4 and 5 in August 2007 and August 2008, respectively. Three programs were hospital-affiliated OTPs (sites 1, 3, and 5), and two were independent programs (sites 2 and 4). The OTP censuses ranged from 153 to 1007. All sites provided methadone maintenance therapy, and site 1 also provided buprenorphine maintenance therapy. Sites 1 and 5 had on-site HIV care available throughout the study, sites 2 and 3 had on-site HIV care available for part of the study period, and site 4 did not have on-site HIV-care PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/29072704 services.EligibilityResearch assistants, employed full-time at the sites and familiar with the OTP clients, were responsible for recruitment and initial screening of participants. We posted study flyers at all sites and made regular 4-Hydroxytamoxifen price presentations to counselors, intake specialists, and administrators to describe the purpose of th.

6) NMDAR-E Number Females Age (years)NC 37 21 (57 ) 40 (23?9) 0 (0 ) 0 (0 ) NC 16 9 (56 ) 28 (4?0) 0 (0 ) 0 (0 )HC 32 27 (84 ) 43 (27?8) 0 (0 ) 0 (0 )p-value 0.0452 0.0013 <0.00012 <0.00012 p-value 0.7164 0.0015 <0.00014 <0.7 5 (71 ) 20 (5?4) 7 (100 ) 6 (86 ) NMDAR-ECBA

6) NMDAR-E Number Females Age (years)NC 37 21 (57 ) 40 (23?9) 0 (0 ) 0 (0 ) NC 16 9 (56 ) 28 (4?0) 0 (0 ) 0 (0 )HC 32 27 (84 ) 43 (27?8) 0 (0 ) 0 (0 )p-value 0.0452 0.0013 <0.00012 <0.00012 p-value 0.7164 0.0015 <0.00014 <0.7 5 (71 ) 20 (5?4) 7 (100 ) 6 (86 ) NMDAR-ECBA NMDAR IgG FACS NMDAR IgG Validation group (n = 32) Number Females Age (years)16 11 (69 ) 16 (3?2) 16 (100 ) 14 (87 )CBA NMDAR IgG FACS NMDAR IgGCBA = cell-based assay. FACS = fluorescence activated cell sorting. HC = healthy controls. NC = neurological controls. NMDAR-E = N-methyl-D1 2 3 4aspartate receptor encephalitis. Data are shown as median (range), p-value: groups were compared using Chi-Square test and Kruskal-Wallis test, Fisher's exact test and Mann-Whitney U test.doi:10.1371/journal.pone.0122037.tneurological controls (neuromyelitis optica n = 4, multiple sclerosis n = 1, patients with suspected autoimmune encephalitis, including limbic encephalitis, non-focal encephalitis, encephalomyelitis, cerebellar dysfunction, and one patient with hypophysitis n = 11). Diagnosis of NMDAR encephalitis was based on clinical assessment (new onset of neuropsychiatric symptoms) and demonstration of antibodies in serum or CSF with at fpsyg.2016.01503 least two assays (CBA with fixed cells and tissue immunohistochemistry) as recommended recently [16]. In the discovery group the fpsyg.2014.00822 clinical diagnosis of NMDAR encephalitis diagnosis was confirmed by the presence of NMDAR antibodies in the serum and CSF of patients. One sample was tested in a diagnostic laboratory (Oxford Neuroimmunology Testing Service, Oxford, UK), two AZD3759 cancer Samples were tested in our laboratory using a commercially available certified test kit (Euroimmun AG, L eck, Germany), and four samples were tested in both laboratories. In the blinded validation group from Barcelona diagnosis was confirmed by the research center of neuroimmunology (IDIBAPS, Hospital Cl ic, University of Barcelona, Spain) using an in-house CBA and tissue immunohistochemistry in CSF and serum samples. Antibody negativity was proven for all control samples of the validation group. All samples of the validation group were blinded by RH and JD. The demographic data of both groups are shown in Table 1. The present study was approved by the Ethical Committee of the Medical University of Innsbruck (study numbers AM3041A and AM4059). All patients and controls gave written informed consent to the study protocol. All samples from the Hospital Cl ic Barcelona were deposited in the collection of GW 4064MedChemExpress GW 4064 biological samples named “neuroimmunologia” registered in the biobank of IDIBAPS, Barcelona, Spain. Samples were handled in an anonymized way, thus the Comit? ico de Investigaci Cl ica of Hospital Cl ic de Barcelona accepted to waive the specific written informed consent from the patients or next of kin.PLOS ONE | DOI:10.1371/journal.pone.0122037 March 27,3 /A Live Cell Based Assay for Detection of NMDAR AntibodiesTransient expression of human NMDAR in HEK293A cells and live cellbased immunofluorescence assay (CBA)Complementary DNA (cDNA) of human (h)GRIN1, NM_000832.5, (Origene, Rockville, MD) was amplified and cloned into the mammalian expression vector Vivid Colors pcDNA 6.2C-EmGFP-GW/TOPO (Life Technologies, Carlsbad, CA), resulting in hGRIN1 C-terminally fused to emerald green fluorescent protein (EmGFP). Correct insert sequence was verified by DNA sequencing (Microsynth, Balgach, Switzerland). Human GRIN2A cDNA (NM_000833.3, expression vector pDEST26) was purchased from Source Bio.6) NMDAR-E Number Females Age (years)NC 37 21 (57 ) 40 (23?9) 0 (0 ) 0 (0 ) NC 16 9 (56 ) 28 (4?0) 0 (0 ) 0 (0 )HC 32 27 (84 ) 43 (27?8) 0 (0 ) 0 (0 )p-value 0.0452 0.0013 <0.00012 <0.00012 p-value 0.7164 0.0015 <0.00014 <0.7 5 (71 ) 20 (5?4) 7 (100 ) 6 (86 ) NMDAR-ECBA NMDAR IgG FACS NMDAR IgG Validation group (n = 32) Number Females Age (years)16 11 (69 ) 16 (3?2) 16 (100 ) 14 (87 )CBA NMDAR IgG FACS NMDAR IgGCBA = cell-based assay. FACS = fluorescence activated cell sorting. HC = healthy controls. NC = neurological controls. NMDAR-E = N-methyl-D1 2 3 4aspartate receptor encephalitis. Data are shown as median (range), p-value: groups were compared using Chi-Square test and Kruskal-Wallis test, Fisher's exact test and Mann-Whitney U test.doi:10.1371/journal.pone.0122037.tneurological controls (neuromyelitis optica n = 4, multiple sclerosis n = 1, patients with suspected autoimmune encephalitis, including limbic encephalitis, non-focal encephalitis, encephalomyelitis, cerebellar dysfunction, and one patient with hypophysitis n = 11). Diagnosis of NMDAR encephalitis was based on clinical assessment (new onset of neuropsychiatric symptoms) and demonstration of antibodies in serum or CSF with at fpsyg.2016.01503 least two assays (CBA with fixed cells and tissue immunohistochemistry) as recommended recently [16]. In the discovery group the fpsyg.2014.00822 clinical diagnosis of NMDAR encephalitis diagnosis was confirmed by the presence of NMDAR antibodies in the serum and CSF of patients. One sample was tested in a diagnostic laboratory (Oxford Neuroimmunology Testing Service, Oxford, UK), two samples were tested in our laboratory using a commercially available certified test kit (Euroimmun AG, L eck, Germany), and four samples were tested in both laboratories. In the blinded validation group from Barcelona diagnosis was confirmed by the research center of neuroimmunology (IDIBAPS, Hospital Cl ic, University of Barcelona, Spain) using an in-house CBA and tissue immunohistochemistry in CSF and serum samples. Antibody negativity was proven for all control samples of the validation group. All samples of the validation group were blinded by RH and JD. The demographic data of both groups are shown in Table 1. The present study was approved by the Ethical Committee of the Medical University of Innsbruck (study numbers AM3041A and AM4059). All patients and controls gave written informed consent to the study protocol. All samples from the Hospital Cl ic Barcelona were deposited in the collection of biological samples named “neuroimmunologia” registered in the biobank of IDIBAPS, Barcelona, Spain. Samples were handled in an anonymized way, thus the Comit? ico de Investigaci Cl ica of Hospital Cl ic de Barcelona accepted to waive the specific written informed consent from the patients or next of kin.PLOS ONE | DOI:10.1371/journal.pone.0122037 March 27,3 /A Live Cell Based Assay for Detection of NMDAR AntibodiesTransient expression of human NMDAR in HEK293A cells and live cellbased immunofluorescence assay (CBA)Complementary DNA (cDNA) of human (h)GRIN1, NM_000832.5, (Origene, Rockville, MD) was amplified and cloned into the mammalian expression vector Vivid Colors pcDNA 6.2C-EmGFP-GW/TOPO (Life Technologies, Carlsbad, CA), resulting in hGRIN1 C-terminally fused to emerald green fluorescent protein (EmGFP). Correct insert sequence was verified by DNA sequencing (Microsynth, Balgach, Switzerland). Human GRIN2A cDNA (NM_000833.3, expression vector pDEST26) was purchased from Source Bio.

Porally-defined global form0.**0.**0.SPM = Raven’s Standard Progressive Matrices. * p < 0.05. ** p

Porally-defined global form0.**0.**0.SPM = Raven’s Standard Progressive Matrices. * p < 0.05. ** p < 0.01. *** p < 0.001.3.2. Regression analyses: Between-group jasp.12117 Results from the series of between-group regression analyses revealed significant group differences for some of the visual tasks. Raw coherence thresholds for the group of readers with dyslexia and relatively good readers are reported in Table 5. For each task, results from the between-group regression analyses are reported in Table 6 and described in the sections below. 3.2.1. Random-dot global motion In the regression model for the random-dot global motion task, the control variables explained 19 of the variance, F2, 83 = 9.89, p < 0.001. Gender was associated with performance on the task. Females' coherence thresholds were significantly higher than those of males. In addition, Non-Verbal IQ was a significant predictor of performance. Individuals with a lower IQ had higher coherence thresholds on the random-dot global motion task. At step two, the R2 change was significant, F1, 82 = 8.25, p < 0.01. Reading Group was associated with performance on the task. It explained an Nutlin-3a chiral supplier additional 8 of the variance after controlling for the effects of Gender and Non-Verbal IQ. Coherence thresholds were significantly higher in readers with dyslexia who had poor phonemic decoding skills. 3.2.2. Spatially 1-D global motion The control variables explained 6 of the variance in the model for the spatially 1-D global motion task, F2, 83 = 2.55, p = 0.08. There was no significant effect of Gender but Non-Verbal IQ was negatively associated with performance. Individuals with a lower IQ had higher coherence thresholds on the spatially 1-D global motion task. The R2 change at step two approached but did not reach statistical significance, F1, 82 = 3.20, p = 0.08. Coherencethresholds did not differ between the two reader groups. However, there was a non-significant trend. 3.2.3. Static global form Gender and Non-Verbal IQ did not explain a significant amount of variance in the model for static global form task, F2, 83 = 0.11, p = 0.90. Moreover, the R2 change at step two failed to reach statistical significance, F1, 82 = 0.10, p = 0.75. Reading Group was not associated with performance on the static global form task. Coherence thresholds did not differ significantly between the two groups. 3.2.4. Temporally-defined global form The control variables did not explain a significant amount of j.jebo.2013.04.005 variance in the model for the temporally-defined global form task, F2, 83 = 1.49, p = 0.23. However, the R2 change at step two was significant, F1, 82 = 6.02, p = 0.02. Reading Group was associated with performance on the task. It explained an additional 7 of the variance after controlling for the effects of Gender and Non-Verbal IQ. Coherence thresholds were significantly higher in the group of readers with dyslexia who had poor phonemic decoding skills. 3.3. Independence of visual tasks Scatterplots illustrating performance of the entire sample GDC-0084 dose across the four visual tasks are given in Fig. 3. As expected, a strong and significant correlation was found between thresholds across the two global motion tasks and the two global form tasks (random-dot global motion task and spatially 1-D global motion task, r106 = 0.58, p < 0.001; static global form task and temporally-defined global form task, r106 = 0.23, p = 0.02).R. Johnston et al. / Brain and Cognition 108 (2016) 20?1 Table 5 Group coherence threshold ( ) statisti.Porally-defined global form0.**0.**0.SPM = Raven's Standard Progressive Matrices. * p < 0.05. ** p < 0.01. *** p < 0.001.3.2. Regression analyses: Between-group jasp.12117 Results from the series of between-group regression analyses revealed significant group differences for some of the visual tasks. Raw coherence thresholds for the group of readers with dyslexia and relatively good readers are reported in Table 5. For each task, results from the between-group regression analyses are reported in Table 6 and described in the sections below. 3.2.1. Random-dot global motion In the regression model for the random-dot global motion task, the control variables explained 19 of the variance, F2, 83 = 9.89, p < 0.001. Gender was associated with performance on the task. Females' coherence thresholds were significantly higher than those of males. In addition, Non-Verbal IQ was a significant predictor of performance. Individuals with a lower IQ had higher coherence thresholds on the random-dot global motion task. At step two, the R2 change was significant, F1, 82 = 8.25, p < 0.01. Reading Group was associated with performance on the task. It explained an additional 8 of the variance after controlling for the effects of Gender and Non-Verbal IQ. Coherence thresholds were significantly higher in readers with dyslexia who had poor phonemic decoding skills. 3.2.2. Spatially 1-D global motion The control variables explained 6 of the variance in the model for the spatially 1-D global motion task, F2, 83 = 2.55, p = 0.08. There was no significant effect of Gender but Non-Verbal IQ was negatively associated with performance. Individuals with a lower IQ had higher coherence thresholds on the spatially 1-D global motion task. The R2 change at step two approached but did not reach statistical significance, F1, 82 = 3.20, p = 0.08. Coherencethresholds did not differ between the two reader groups. However, there was a non-significant trend. 3.2.3. Static global form Gender and Non-Verbal IQ did not explain a significant amount of variance in the model for static global form task, F2, 83 = 0.11, p = 0.90. Moreover, the R2 change at step two failed to reach statistical significance, F1, 82 = 0.10, p = 0.75. Reading Group was not associated with performance on the static global form task. Coherence thresholds did not differ significantly between the two groups. 3.2.4. Temporally-defined global form The control variables did not explain a significant amount of j.jebo.2013.04.005 variance in the model for the temporally-defined global form task, F2, 83 = 1.49, p = 0.23. However, the R2 change at step two was significant, F1, 82 = 6.02, p = 0.02. Reading Group was associated with performance on the task. It explained an additional 7 of the variance after controlling for the effects of Gender and Non-Verbal IQ. Coherence thresholds were significantly higher in the group of readers with dyslexia who had poor phonemic decoding skills. 3.3. Independence of visual tasks Scatterplots illustrating performance of the entire sample across the four visual tasks are given in Fig. 3. As expected, a strong and significant correlation was found between thresholds across the two global motion tasks and the two global form tasks (random-dot global motion task and spatially 1-D global motion task, r106 = 0.58, p < 0.001; static global form task and temporally-defined global form task, r106 = 0.23, p = 0.02).R. Johnston et al. / Brain and Cognition 108 (2016) 20?1 Table 5 Group coherence threshold ( ) statisti.

Proach in developing ICU prognostic models. The Bayesian approach considers data

Proach in developing ICU prognostic models. The Bayesian approach considers data to be fixed and assumes Necrostatin-1 biological activity parameters as random variables, where the uncertainty of unknown parameters is taken into consideration via probability theory. This provides a degree of uncertainty in the model, yielding predictions that are more realistic and safeguards against overfitting of models more than frequentist approaches. Moreover, the Bayesian approach relies on exact inference, instead of large sample asymptotic approximations. This facilitates an easier and more intuitive interpretation of the credible intervals of the estimated parameters of a predictive model. The flexibility of the Bayesian approach to update prior information about the underlying parameters with information from cumulative or past experience is also considered one of its advantages [10]. Despite these advantages, the Bayesian approach is not so popular because it is often computationally intensive, especially for models that involve many variables. Its application requires the use of specialized software and the buy L-660711 sodium salt knowledge to perform MCMC analyses. As such, the Bayesian approach is underutilized in areas of prognostic modeling for general ICU mortality outcomes. Although there were several studies that applied Bayesian MCMC for prediction of in-hospital risk of death, their areas were limited to specific subgroups of patients with diseases such as trauma [11], cancer and AIDS [12], acute myocardial infarction [13] and malaria [14]. These studies were mostly focused on application of Bayesian MCMC approach in variable selection and model choice. In this study, the Bayesian MCMC approach was used for identification of significant risk predictors and estimation of model parameters.Materials and Methods Data collectionThis prospective study involved a cohort of 1,286 critically ill patients who were admitted to the Hospital Sultanah Aminah Johor Bahru (HSA) ICU between January 1, 2009 and June 30, 2010. The single multidisciplinary ICU in HSA is equipped with sixteen beds and provides services to general medical, surgical and trauma patients. Post-coronary artery bypass graft (CABG) patients were excluded from the study because these patients receive treatment in a separate unit in the hospital. Patients who were below 16 years of age, those who were transferred from another ICU/hospital, with less than 4 hours of ICU stay, as well as, patients who were seeking jir.2012.0140 treatment for burns and transplant procedures were excluded from analysis. Data from the first admission was used for patients with multiple admissions. A total of 1,111 patients met the inclusion criteria and were considered for the study. This study was approved by the Medical Research and Ethics Committee, Ministry of Health, Malaysia. The requirement for informed consent from all participants was waived because data collection was based on existing medical and laboratory records and there was no clinical intervention in this study. Patient records or information were anonymized and deidentified prior to analysis. Routine data collection was manually performed by HSA ICU nurses, and then manually transferred to an online database by the medical officers. Individual user accounts were created for each of the data entry personnel in order to preserve SART.S23503 data integrity and traceability. Data collected at the time of ICU admission included socio-demographic (age, gender and ethnicity), admission (date and time of admission, source.Proach in developing ICU prognostic models. The Bayesian approach considers data to be fixed and assumes parameters as random variables, where the uncertainty of unknown parameters is taken into consideration via probability theory. This provides a degree of uncertainty in the model, yielding predictions that are more realistic and safeguards against overfitting of models more than frequentist approaches. Moreover, the Bayesian approach relies on exact inference, instead of large sample asymptotic approximations. This facilitates an easier and more intuitive interpretation of the credible intervals of the estimated parameters of a predictive model. The flexibility of the Bayesian approach to update prior information about the underlying parameters with information from cumulative or past experience is also considered one of its advantages [10]. Despite these advantages, the Bayesian approach is not so popular because it is often computationally intensive, especially for models that involve many variables. Its application requires the use of specialized software and the knowledge to perform MCMC analyses. As such, the Bayesian approach is underutilized in areas of prognostic modeling for general ICU mortality outcomes. Although there were several studies that applied Bayesian MCMC for prediction of in-hospital risk of death, their areas were limited to specific subgroups of patients with diseases such as trauma [11], cancer and AIDS [12], acute myocardial infarction [13] and malaria [14]. These studies were mostly focused on application of Bayesian MCMC approach in variable selection and model choice. In this study, the Bayesian MCMC approach was used for identification of significant risk predictors and estimation of model parameters.Materials and Methods Data collectionThis prospective study involved a cohort of 1,286 critically ill patients who were admitted to the Hospital Sultanah Aminah Johor Bahru (HSA) ICU between January 1, 2009 and June 30, 2010. The single multidisciplinary ICU in HSA is equipped with sixteen beds and provides services to general medical, surgical and trauma patients. Post-coronary artery bypass graft (CABG) patients were excluded from the study because these patients receive treatment in a separate unit in the hospital. Patients who were below 16 years of age, those who were transferred from another ICU/hospital, with less than 4 hours of ICU stay, as well as, patients who were seeking jir.2012.0140 treatment for burns and transplant procedures were excluded from analysis. Data from the first admission was used for patients with multiple admissions. A total of 1,111 patients met the inclusion criteria and were considered for the study. This study was approved by the Medical Research and Ethics Committee, Ministry of Health, Malaysia. The requirement for informed consent from all participants was waived because data collection was based on existing medical and laboratory records and there was no clinical intervention in this study. Patient records or information were anonymized and deidentified prior to analysis. Routine data collection was manually performed by HSA ICU nurses, and then manually transferred to an online database by the medical officers. Individual user accounts were created for each of the data entry personnel in order to preserve SART.S23503 data integrity and traceability. Data collected at the time of ICU admission included socio-demographic (age, gender and ethnicity), admission (date and time of admission, source.

Ariables using a propensity score analysis; (III) and finally, competing risks

Ariables using a propensity score analysis; (III) and finally, competing risks were taken into account in all analysis. In conclusion, hypokalemia was significantly associated with higher risk of cardiovascular, infectious and all-cause mortality, even after adjustments for competing risks and with wellbalanced groups. The underlying mechanisms behind the association of hypokalemia and infectious mortality deserve further investigation. Finally, our results raise the need for future intervention studies looking at the effect of hypokalemia bmjopen-2015-010112 Actidione price correction on patient survival.Supporting InformationS1 Table. Potassium variability–Overall population. (DOCX) S2 Table. Potassium variability–Matched patients. (DOCX)PLOS ONE | DOI:10.1371/journal.pone.0127453 June 19,10 /Hypokalemia and Outcomes in Peritoneal DialysisS3 Table. Risk factors for overall mortality. (DOCX) S4 Table. Risk factors for cardiovascular mortality. (DOCX) S5 Table. dar.12119 Risk factors for cardiovascular mortality in the matched cohort. (DOCX) S6 Table. Risk factors for infectious mortality. (DOCX) S7 Table. Independent risk factors for infectious mortality in the matched cohort. (DOCX) S8 Table. Time to first peritonitis episode–Overall population. (DOCX) S9 Table. Time to first peritonitis episode–Matched patients. (DOCX) S1 File. Ethic Review Boards that approved the study. (DOCX)AcknowledgmentsThe following centers participated in BRAZPD and contributed to the preparation of this article: Ameneg, Associa o Hosp. Bauru, Biocor Hosp. Doencas Cardiologicas, Casa de Saude e Mat N. Sra. Perp. Socorro, CDR Curitiba, CDR Goiania, CDR Imperatriz, CDR Sao Jose Pinhais, CDTR_Centro Dialise Transplante Renal, Centro Nefrologia Teresopolis, Centro Nefrologico Minas Gerais, Centro Trat. Doencas AZD-8835 msds Renais Joinville, Centro Tratamento Renal Zona Sul, CLINEF Rio De Janeiro, CLINEPA Clinica de Nefrologia da Paraiba, CLINES, Clinese, Clinica do Rim do Carpina, Clinica Evangelico S/C Ltda, Clinica Nefrologia de Franca, Clinica de Nefrologia Santa Rita, Clinica de Nefrologica Sao Goncalo, Clinica Paulista de Nefrologia, Clinica Renal Manaus, Clinica Senhor Do Bonfim, Clinica Senhor Do Bonfim Ltda Filial, Clinica Tratamento Renal, Cuiaba Cenec, Clire Clinica de Doencas Renais, Famesp Botucatu, Unicamp_Univ. Est Campinas, Hosp. Clinicas FMRPUSP, Funda o Civil Casa Mis Franca, Funda o Inst Mineiro Est Pesq Nefrol, Gamen Rio de Janeiro, Gdf Hospital de Base, Histocom Sociedade Civil Ltda, Hosp Univ Prof Edgard Santos, Hosp Benef. Portuguesa Pernambuco, Hospital Cidade Passo Fundo, Hospital Clinica Univ Fed Goias, Hospital E Maternidade Angelina Caron, Hospital Evangelico Vila Velha Es, Hospital Geral Bonsucesso, Hospital Geral de Goiania, Hospital Infantil Joana de Gusmao, Hospital S Joao Deus, Hospital S Jorge, Hospital S Jose do Avai, Hosp Sao Vicente de Paula_J Pessoa, Hosp Sao Vicente de Paulo, Hospital Servidor do Estado Ipase, Hospital Univ Presidente Dutra Ma, Hospital Universitario Antonio Pedro, Hospital Vita Volta Redonda S/A, Iamspe Sao Paulo, Imip, Inst Capixaba Doencas Renais, Inst Capixaba Doencas Renais Cariacica, Inst Capixaba Doencas Renais Serra, Inst do Rim de Fortaleza, Inst do Rim de Marilia, Inst do Rim do Parana S/C Ltda, Inst do Rim Santo Antonio da Platina, Inst Hemodialise de Sorocaba, Inst Medicina Nuclear Endocrina, Inst Nefrologia de Mogi Das Cruzes, Inst Nefrologia de Suzano, Inst Nefrologia Souza e Costa, Inst Urologia e Nefrol Barra Mansa, Inst Urologia e Nefrol Sj Ri.Ariables using a propensity score analysis; (III) and finally, competing risks were taken into account in all analysis. In conclusion, hypokalemia was significantly associated with higher risk of cardiovascular, infectious and all-cause mortality, even after adjustments for competing risks and with wellbalanced groups. The underlying mechanisms behind the association of hypokalemia and infectious mortality deserve further investigation. Finally, our results raise the need for future intervention studies looking at the effect of hypokalemia bmjopen-2015-010112 correction on patient survival.Supporting InformationS1 Table. Potassium variability–Overall population. (DOCX) S2 Table. Potassium variability–Matched patients. (DOCX)PLOS ONE | DOI:10.1371/journal.pone.0127453 June 19,10 /Hypokalemia and Outcomes in Peritoneal DialysisS3 Table. Risk factors for overall mortality. (DOCX) S4 Table. Risk factors for cardiovascular mortality. (DOCX) S5 Table. dar.12119 Risk factors for cardiovascular mortality in the matched cohort. (DOCX) S6 Table. Risk factors for infectious mortality. (DOCX) S7 Table. Independent risk factors for infectious mortality in the matched cohort. (DOCX) S8 Table. Time to first peritonitis episode–Overall population. (DOCX) S9 Table. Time to first peritonitis episode–Matched patients. (DOCX) S1 File. Ethic Review Boards that approved the study. (DOCX)AcknowledgmentsThe following centers participated in BRAZPD and contributed to the preparation of this article: Ameneg, Associa o Hosp. Bauru, Biocor Hosp. Doencas Cardiologicas, Casa de Saude e Mat N. Sra. Perp. Socorro, CDR Curitiba, CDR Goiania, CDR Imperatriz, CDR Sao Jose Pinhais, CDTR_Centro Dialise Transplante Renal, Centro Nefrologia Teresopolis, Centro Nefrologico Minas Gerais, Centro Trat. Doencas Renais Joinville, Centro Tratamento Renal Zona Sul, CLINEF Rio De Janeiro, CLINEPA Clinica de Nefrologia da Paraiba, CLINES, Clinese, Clinica do Rim do Carpina, Clinica Evangelico S/C Ltda, Clinica Nefrologia de Franca, Clinica de Nefrologia Santa Rita, Clinica de Nefrologica Sao Goncalo, Clinica Paulista de Nefrologia, Clinica Renal Manaus, Clinica Senhor Do Bonfim, Clinica Senhor Do Bonfim Ltda Filial, Clinica Tratamento Renal, Cuiaba Cenec, Clire Clinica de Doencas Renais, Famesp Botucatu, Unicamp_Univ. Est Campinas, Hosp. Clinicas FMRPUSP, Funda o Civil Casa Mis Franca, Funda o Inst Mineiro Est Pesq Nefrol, Gamen Rio de Janeiro, Gdf Hospital de Base, Histocom Sociedade Civil Ltda, Hosp Univ Prof Edgard Santos, Hosp Benef. Portuguesa Pernambuco, Hospital Cidade Passo Fundo, Hospital Clinica Univ Fed Goias, Hospital E Maternidade Angelina Caron, Hospital Evangelico Vila Velha Es, Hospital Geral Bonsucesso, Hospital Geral de Goiania, Hospital Infantil Joana de Gusmao, Hospital S Joao Deus, Hospital S Jorge, Hospital S Jose do Avai, Hosp Sao Vicente de Paula_J Pessoa, Hosp Sao Vicente de Paulo, Hospital Servidor do Estado Ipase, Hospital Univ Presidente Dutra Ma, Hospital Universitario Antonio Pedro, Hospital Vita Volta Redonda S/A, Iamspe Sao Paulo, Imip, Inst Capixaba Doencas Renais, Inst Capixaba Doencas Renais Cariacica, Inst Capixaba Doencas Renais Serra, Inst do Rim de Fortaleza, Inst do Rim de Marilia, Inst do Rim do Parana S/C Ltda, Inst do Rim Santo Antonio da Platina, Inst Hemodialise de Sorocaba, Inst Medicina Nuclear Endocrina, Inst Nefrologia de Mogi Das Cruzes, Inst Nefrologia de Suzano, Inst Nefrologia Souza e Costa, Inst Urologia e Nefrol Barra Mansa, Inst Urologia e Nefrol Sj Ri.

Is noteworthy that different age groups were fpsyg.2015.00360 examined, including 23?4 years old

Is noteworthy that different age groups were examined, including 23?4 years old in the Australian study [3], 2?7 in the US [24] and 14?8 in the Spanish [23]. In these studies, poly-victimisation was assessed using different methods (telephone get PP58 interviews among the US participants and self-completed questionnairePLOS ONE | DOI:10.1371/journal.pone.0125189 May 1,2 /Poly-Victimisation among Vietnamese Adolescents and Correlatesamong the Australian and the Spanish), and different instruments (the JVQ for both the US and the Spanish samples and study specific questions for the Australian). These differences may affect the comparability of the results. In high income countries poly-victimisation has been shown to have independent detrimental effects on the mental health and adjustment capacity of the victims [21, 25?7] even when controlling for exposure to different single forms of victimisation, including physical assault, property crime, peer or sibling victimisation, child maltreatment, sexual victimisation and witness or indirect victimisation.Poly-victimisation among adolescents in low and middle-income countriesEven though 90 of the world’s adolescents live in low and NVP-QAW039 price middle income countries, evidence about the prevalence and correlates of poly-victimisation among them is scarce and most is journal.pone.0174109 from upper-middle income countries. In a sample of 3,155 12-18-year-old high school students in Shandong province China, 85 of whom resided in a rural area, Dong et al [28] found that two thirds of the students reported at least one form of victimisation in the previous year. Polyvictimisation (which was assessed by the JVQ and was defined in this study as exposure to more than four types) was reported by 17 . In another survey in China using the same instrument, Chan reported similar prevalence estimates of 71 reporting experience of at least one form of victimisation and 14 of poly-victimisation [29]. Compared to the Chinese data, findings from a Malaysian study show a much lower prevalence of 22 of adolescents having experienced at least one form of neglect, physical, emotional or sexual victimisation and 3 experiencing all four [30].However, the use of study-specific questions in this survey compared to a validated measure in the two Chinese studies makes the results from Malaysia and China not directly comparable. Evidence from South Africa suggests higher prevalence of exposure to violence among children and adolescents compared to those reported in other settings. Among 617 South African students aged 12?5 years, Kaminer et al [31] found that 93.1 experienced more than one type of violence and more than 50 experienced four or more types, in the six domains investigated (witnessing of community violence, community victimisation, witnessing of domestic violence, domestic victimisation, sexual abuse and school violence). In these studies [28, 30], poly-victimisation was found to be associated with male gender, younger age, lower socioeconomic status, being an only child, poor parent-child relationship and low quality of school and neighbourhood environment.Poly-victimisation among adolescents in VietnamAlthough there are more than 30 million children and adolescents in Vietnam, and they account for more than a third of the nation’s population [32], there is limited evidence about poly-victimisation among them. Most previous studies in Vietnam only investigated specific forms of victimisation. The UNICEF Multi Indicator Cluster Survey 3, i.Is noteworthy that different age groups were examined, including 23?4 years old in the Australian study [3], 2?7 in the US [24] and 14?8 in the Spanish [23]. In these studies, poly-victimisation was assessed using different methods (telephone interviews among the US participants and self-completed questionnairePLOS ONE | DOI:10.1371/journal.pone.0125189 May 1,2 /Poly-Victimisation among Vietnamese Adolescents and Correlatesamong the Australian and the Spanish), and different instruments (the JVQ for both the US and the Spanish samples and study specific questions for the Australian). These differences may affect the comparability of the results. In high income countries poly-victimisation has been shown to have independent detrimental effects on the mental health and adjustment capacity of the victims [21, 25?7] even when controlling for exposure to different single forms of victimisation, including physical assault, property crime, peer or sibling victimisation, child maltreatment, sexual victimisation and witness or indirect victimisation.Poly-victimisation among adolescents in low and middle-income countriesEven though 90 of the world’s adolescents live in low and middle income countries, evidence about the prevalence and correlates of poly-victimisation among them is scarce and most is journal.pone.0174109 from upper-middle income countries. In a sample of 3,155 12-18-year-old high school students in Shandong province China, 85 of whom resided in a rural area, Dong et al [28] found that two thirds of the students reported at least one form of victimisation in the previous year. Polyvictimisation (which was assessed by the JVQ and was defined in this study as exposure to more than four types) was reported by 17 . In another survey in China using the same instrument, Chan reported similar prevalence estimates of 71 reporting experience of at least one form of victimisation and 14 of poly-victimisation [29]. Compared to the Chinese data, findings from a Malaysian study show a much lower prevalence of 22 of adolescents having experienced at least one form of neglect, physical, emotional or sexual victimisation and 3 experiencing all four [30].However, the use of study-specific questions in this survey compared to a validated measure in the two Chinese studies makes the results from Malaysia and China not directly comparable. Evidence from South Africa suggests higher prevalence of exposure to violence among children and adolescents compared to those reported in other settings. Among 617 South African students aged 12?5 years, Kaminer et al [31] found that 93.1 experienced more than one type of violence and more than 50 experienced four or more types, in the six domains investigated (witnessing of community violence, community victimisation, witnessing of domestic violence, domestic victimisation, sexual abuse and school violence). In these studies [28, 30], poly-victimisation was found to be associated with male gender, younger age, lower socioeconomic status, being an only child, poor parent-child relationship and low quality of school and neighbourhood environment.Poly-victimisation among adolescents in VietnamAlthough there are more than 30 million children and adolescents in Vietnam, and they account for more than a third of the nation’s population [32], there is limited evidence about poly-victimisation among them. Most previous studies in Vietnam only investigated specific forms of victimisation. The UNICEF Multi Indicator Cluster Survey 3, i.

Ts, symptoms are initially psychiatric with insomnia and agitation, followed by

Ts, symptoms are initially psychiatric with insomnia and TAPI-2 web agitation, followed by dyskinesias, seizures, memory deficits, speech problems and a decrease in the level of consciousness often leading to autonomic instabilities [5?]. In children, the first symptoms are often seizures or dyskinesias, subsequently progressing to develop the other components of the syndrome. Immunotherapy is effective in most patients, limiting the frequency of relapses and lethality [4]. After the first description of NMDAR antibodies, purchase DM-3189 patients initially presenting with encephalitic and epileptic symptoms of unknown origin became more frequently diagnosed with NMDAR encephalitis [3, 4, 8?4]. The gold standard for the detection of disease specific NMDAR antibodies, which is crucial for the diagnosis of NMDAR encephalitis, comprises testing the immunoreactive binding of serum and cerebrospinal fluid (CSF) samples to fixed and permeabilized NMDAR transfected cells (fixed cell-based assay [CBA]) and immunohistochemistry of frozen sections of 1471-2474-14-48 rat brain optimized for the detection of antibodies against cell surface or synaptic proteins [5, 15]. Alternatively, CBA using live cells with subsequent fixation can be used to detect autoantibodies against NMDAR [7], although the live CBA was suggested to have a lower sensitivity compared to the fixed CBA [16]. NMDAR are heterotetramers composed of three different NMDAR subunits (NR1-3). Whereas NR1 is ubiquitously present and required for expression of functional NMDAR on the cell surface, distinct NR2(A-D) and NR3(A, B) subunits assemble with NR1 [17]. Hippocampal NMDAR are predominantly composed of NR1 in combination with NR2A and/or NR2B, with an age-dependent shift from NR2B to NR2A [18]. It is now well established that antibodies from NMDAR encephalitis patients are of the immunoglobulin G (IgG) subclass and react with an N-terminal epitope on the NR1 subunit. The binding to NR1 depends on the conformation of the antigen using either live or fixed NMDAR expressing cells, with or without the presence of NR2 subunits [5, 16, 19]. In the present study we compare another live CBA using HEK293A cells expressing NR1/ NR2A/NR2B containing functional NMDAR followed by microscopic analysis to a flow cytometry (FACS) based analysis of the test, since the evaluation of cell surface staining by fluorescence microscopy is strongly dependent on the experience of the investigators. Furthermore, a FACS based analysis to detect antibodies to surface antigens would enable quantification of antibody levels over time and also to precisely calculate intrathecal synthesis of the antibodies in those diseases. To assess diagnostic accuracy we evaluate the performance of the two detection methods used.Materials and Methods PatientsSerum samples from patients and controls were collected in the Clinical Department of Neurology Innsbruck and the Hospital Cl ic Barcelona between 2005 and 2013, and stored at -80 jir.2010.0097 until use. The discovery group (76 individuals from Innsbruck) consisted of seven patients with NMDAR encephalitis, 37 neurological controls (multiple sclerosis n = 33, clinically isolated syndrome n = 3, viral encephalitis n = 1) and 32 healthy controls. The validation group (32 patients from Barcelona) consisted of 16 patients with NMDAR encephalitis andPLOS ONE | DOI:10.1371/journal.pone.0122037 March 27,2 /A Live Cell Based Assay for Detection of NMDAR AntibodiesTable 1. Demographic data of patients and controls. Discovery group (n = 7.Ts, symptoms are initially psychiatric with insomnia and agitation, followed by dyskinesias, seizures, memory deficits, speech problems and a decrease in the level of consciousness often leading to autonomic instabilities [5?]. In children, the first symptoms are often seizures or dyskinesias, subsequently progressing to develop the other components of the syndrome. Immunotherapy is effective in most patients, limiting the frequency of relapses and lethality [4]. After the first description of NMDAR antibodies, patients initially presenting with encephalitic and epileptic symptoms of unknown origin became more frequently diagnosed with NMDAR encephalitis [3, 4, 8?4]. The gold standard for the detection of disease specific NMDAR antibodies, which is crucial for the diagnosis of NMDAR encephalitis, comprises testing the immunoreactive binding of serum and cerebrospinal fluid (CSF) samples to fixed and permeabilized NMDAR transfected cells (fixed cell-based assay [CBA]) and immunohistochemistry of frozen sections of 1471-2474-14-48 rat brain optimized for the detection of antibodies against cell surface or synaptic proteins [5, 15]. Alternatively, CBA using live cells with subsequent fixation can be used to detect autoantibodies against NMDAR [7], although the live CBA was suggested to have a lower sensitivity compared to the fixed CBA [16]. NMDAR are heterotetramers composed of three different NMDAR subunits (NR1-3). Whereas NR1 is ubiquitously present and required for expression of functional NMDAR on the cell surface, distinct NR2(A-D) and NR3(A, B) subunits assemble with NR1 [17]. Hippocampal NMDAR are predominantly composed of NR1 in combination with NR2A and/or NR2B, with an age-dependent shift from NR2B to NR2A [18]. It is now well established that antibodies from NMDAR encephalitis patients are of the immunoglobulin G (IgG) subclass and react with an N-terminal epitope on the NR1 subunit. The binding to NR1 depends on the conformation of the antigen using either live or fixed NMDAR expressing cells, with or without the presence of NR2 subunits [5, 16, 19]. In the present study we compare another live CBA using HEK293A cells expressing NR1/ NR2A/NR2B containing functional NMDAR followed by microscopic analysis to a flow cytometry (FACS) based analysis of the test, since the evaluation of cell surface staining by fluorescence microscopy is strongly dependent on the experience of the investigators. Furthermore, a FACS based analysis to detect antibodies to surface antigens would enable quantification of antibody levels over time and also to precisely calculate intrathecal synthesis of the antibodies in those diseases. To assess diagnostic accuracy we evaluate the performance of the two detection methods used.Materials and Methods PatientsSerum samples from patients and controls were collected in the Clinical Department of Neurology Innsbruck and the Hospital Cl ic Barcelona between 2005 and 2013, and stored at -80 jir.2010.0097 until use. The discovery group (76 individuals from Innsbruck) consisted of seven patients with NMDAR encephalitis, 37 neurological controls (multiple sclerosis n = 33, clinically isolated syndrome n = 3, viral encephalitis n = 1) and 32 healthy controls. The validation group (32 patients from Barcelona) consisted of 16 patients with NMDAR encephalitis andPLOS ONE | DOI:10.1371/journal.pone.0122037 March 27,2 /A Live Cell Based Assay for Detection of NMDAR AntibodiesTable 1. Demographic data of patients and controls. Discovery group (n = 7.

Pment in mice although also B. burgdorferi strains that express DbpA

Pment in mice although also B. burgdorferi strains that express DbpA or B alone, or the strain that is DbpA/B deficient, are able to colonize mouse joints. The progression of the joint manifestations in dbpAB/dbpAB infected mice is biphasic with peaks at 4 and 9?1 weeks of infection, and with histologically evident arthritis at 15 weeks of infection. The most important finding of the present study is the absence of post treatment borrelial DNA persistence in the joints of mice infected with DbpA/B deficient B. burgdorferi, while in the mice infected DbpA and B expressing B. burgdorferi, all joint samples were borrelial DNA positive up to 12 weeks after the treatment. One obvious explanation for this phenomenon is that DbpA and B assist the bacteria in invasion to decorin rich foci in mouse joints, which in turn allows evasion of antibiotic treatment and leads to post-treatment persistence of bacterial remnants in mouse joints. Based on the results of our anti-TNF-alpha immunosuppression experiments, the nature of the persisting material in the antibiotic treated mice appears to be non-cultivable bacterial remnants. The finding that only B. burgdorferi with a particular set of adhesins can form deposits of persisting remnants after treatment is thought provoking. We and others have shown that DbpA and journal.pone.0174109 B molecules of different B. burgdorferi sensu lato genospecies have different abilities to mediate binding to decorin and to decorin fpsyg.2014.00822 expressing cells [22, 26, 32]. Therefore, we will next focus on evaluating the contribution of DbpA and B of different B. burgdorferi sensu lato genospecies to dissemination of the infection, to arthritis development and to the post treatment persistence potential.Supporting InformationS1 Fig. IgG antibodies against C6, DbpA and DbpB in mouse serum samples. Antibody levels were measured using enzyme immunoassays with C6 peptide (A and D), DbpA (B and E) and DbpB (C and F) as antigens. Each symbol represents the result of an individual animal. Results are expressed as OD492 values and all samples were analysed in duplicate. The linePLOS ONE | DOI:10.1371/journal.pone.0121512 March 27,15 /DbpA and B Promote Arthritis and Post-Treatment Persistence in Miceindicates the mean of each group. Groups with same letter do not differ at 5 level of probability (Tukey’s HSD test). (TIF)AcknowledgmentsWe thank Fang-Ting Liang, Department of GW 4064 web Pathobiological Sciences, Louisiana State University, Baton Rouge, Louisiana, USA for providing the B. burgdorferi strains used in the study, Seppo Neuvonen for help in statistical analyses, and Tiina Haarala, Tiina M il? Kirsi Sundholm-Heino and Anna Karvonen for excellent technical assistance. Centocor Research Development, Inc., Malvern, Pennsylvania, USA is acknowledged for providing anti-TNFalpha antibody.Author ContributionsConceived and designed the experiments: JS MKV JH. Performed the experiments: JS AJ MS JH. Analyzed the data: JS AJ MS JH. Contributed reagents/materials/analysis tools: JS MS MKV JH. Wrote the paper: JS AJ MS MKV JH.
With the identification of antibodies against N-methyl-D-aspartate receptors (NMDAR) a new subgroup of SIS3MedChemExpress SIS3 autoimmune encephalitis was described in 2007 [1]. The association of prominent psychiatric symptoms in the context of severe encephalitis and an underlying ovarian teratoma initially facilitated the discovery of this disorder [1, 2]. A majority of patients are female and the disease often occurs in childhood or early adolescence [3, 4]. In adul.Pment in mice although also B. burgdorferi strains that express DbpA or B alone, or the strain that is DbpA/B deficient, are able to colonize mouse joints. The progression of the joint manifestations in dbpAB/dbpAB infected mice is biphasic with peaks at 4 and 9?1 weeks of infection, and with histologically evident arthritis at 15 weeks of infection. The most important finding of the present study is the absence of post treatment borrelial DNA persistence in the joints of mice infected with DbpA/B deficient B. burgdorferi, while in the mice infected DbpA and B expressing B. burgdorferi, all joint samples were borrelial DNA positive up to 12 weeks after the treatment. One obvious explanation for this phenomenon is that DbpA and B assist the bacteria in invasion to decorin rich foci in mouse joints, which in turn allows evasion of antibiotic treatment and leads to post-treatment persistence of bacterial remnants in mouse joints. Based on the results of our anti-TNF-alpha immunosuppression experiments, the nature of the persisting material in the antibiotic treated mice appears to be non-cultivable bacterial remnants. The finding that only B. burgdorferi with a particular set of adhesins can form deposits of persisting remnants after treatment is thought provoking. We and others have shown that DbpA and journal.pone.0174109 B molecules of different B. burgdorferi sensu lato genospecies have different abilities to mediate binding to decorin and to decorin fpsyg.2014.00822 expressing cells [22, 26, 32]. Therefore, we will next focus on evaluating the contribution of DbpA and B of different B. burgdorferi sensu lato genospecies to dissemination of the infection, to arthritis development and to the post treatment persistence potential.Supporting InformationS1 Fig. IgG antibodies against C6, DbpA and DbpB in mouse serum samples. Antibody levels were measured using enzyme immunoassays with C6 peptide (A and D), DbpA (B and E) and DbpB (C and F) as antigens. Each symbol represents the result of an individual animal. Results are expressed as OD492 values and all samples were analysed in duplicate. The linePLOS ONE | DOI:10.1371/journal.pone.0121512 March 27,15 /DbpA and B Promote Arthritis and Post-Treatment Persistence in Miceindicates the mean of each group. Groups with same letter do not differ at 5 level of probability (Tukey’s HSD test). (TIF)AcknowledgmentsWe thank Fang-Ting Liang, Department of Pathobiological Sciences, Louisiana State University, Baton Rouge, Louisiana, USA for providing the B. burgdorferi strains used in the study, Seppo Neuvonen for help in statistical analyses, and Tiina Haarala, Tiina M il? Kirsi Sundholm-Heino and Anna Karvonen for excellent technical assistance. Centocor Research Development, Inc., Malvern, Pennsylvania, USA is acknowledged for providing anti-TNFalpha antibody.Author ContributionsConceived and designed the experiments: JS MKV JH. Performed the experiments: JS AJ MS JH. Analyzed the data: JS AJ MS JH. Contributed reagents/materials/analysis tools: JS MS MKV JH. Wrote the paper: JS AJ MS MKV JH.
With the identification of antibodies against N-methyl-D-aspartate receptors (NMDAR) a new subgroup of autoimmune encephalitis was described in 2007 [1]. The association of prominent psychiatric symptoms in the context of severe encephalitis and an underlying ovarian teratoma initially facilitated the discovery of this disorder [1, 2]. A majority of patients are female and the disease often occurs in childhood or early adolescence [3, 4]. In adul.

Tempt to get evidence for a hypothetical lipid flippase activity of

Tempt to get evidence for a hypothetical lipid flippase activity of Flc proteins we used standard tests to measure lipid biosynthesis in flc mutants. For this 123ty cells were labeled with [3H]-C16:0 or [3H]-myo-inositol after 16 h of culture with or without Doxy, the time it takes to see a slow down of the growth rate of Doxytreated cells in comparison with non-treated cells (S3A Fig (Division times of single or combined flc mutants)). When the cells were grown with Doxy in the absence of 1.4 M sorbitol, [3H]-C16:0 incorporation into GPLs and sphingolipids in 123ty cells was very low (Fig 4A). (Sphingolipids are the only polar lipids remaining after NaOH treatment). When grown in sorbitol, the synthesis rate of GPLs was brought back, although not to WT levels (Fig 4B). This difference could not be attributed to a difference in cell viability since colony forming units (CFU) after 16 h of culture on Doxy with and without sorbitol was the same (39 and 41 , respectively, compared to cells not treated with Doxy). In spite of reduced viability by this criterion, all cells still retained a full redox potential (see below). Differently from GPLs, sphingolipid biosynthesis remained inefficient in Doxy treated 123ty cells even on sorbitol, both ifPLOS Genetics | DOI:10.1371/journal.pgen.July 27,7 /Yeast E-MAP for Identification of Membrane Transporters Operating Lipid Flip FlopFig 4. Lipid biosynthesis of 123ty mutants assessed by metabolic labeling. (A ) WT or 123ty cells incubated with or without 10 g/ml Doxy for the indicated times in YPD (A) or YPD + 1.4 M sorbitol (B), were radiolabeled with [3H]-C16:0 for the indicated times at 30 , the lipids were extracted, treated with NaOH as indicated, spotted and separated by TLC using solvent 1. (C) same as in (B) but additional 25 M of cold C16:0 were added during labeling and lipids were separated by TLC with solvent 2. (D) cells grown with or without 10 g/ml Doxy for 16 h in inositol-free SC + 1.4 M sorbitol were labeled with [3H]-myo-inositol for 2 h and the lipids from 10 OD600 of each cell type were processed as in (C). NL = neutral lipids are free FAs, DAG, TAG, ergosterol esters and (acyl-)ceramides. doi:10.1371/journal.pgen.1006160.g[3H]-C16:0 or [3H]-myo-inositol was used to label cells (Fig 4C and 4D). In Doxy treated 123ty mutants, the incorporation of [3H]-myo-inositol tended to remain in the form of phosphatidylinositol (PI) (Fig 4D). Accumulation of PI is expected when ceramides are not made in sufficient quantity since most PI is normally consumed by Aur1-Kei1 transferring inositol-phosphate from PI to ceramides thus generating inositolphosphorylceramides. Three possible ICG-001 web reasons for the reduction of the lipid biosynthesis rate in Doxy treated 123ty mutants came to our mind: 1) The proposed lack of FAD [30] would lead to a severe dysfunction of Ero1 and Pdi1 and a lack of proper oxidative folding of some ER proteins, also affecting enzymes involved in lipid biosynthesis [35]. 2) The reduced activity of the lipid biosynthetic enzymes would be related to the growth arrest the cells undergo when incubated with Doxy and 3) The flc mutants would indeed have a defect in flipping acyl-CoA or GPLs from the cytosol into the lumen of the ER. To get evidence for a flippase defect in flc mutants, we measured the acyl transferase activity of RG1662 dose microsomes in presence of very low concentrations of 16:0-CoA hoping that low concentrations of acyl-CoA would make the PA synthesis more dependent on flippa.Tempt to get evidence for a hypothetical lipid flippase activity of Flc proteins we used standard tests to measure lipid biosynthesis in flc mutants. For this 123ty cells were labeled with [3H]-C16:0 or [3H]-myo-inositol after 16 h of culture with or without Doxy, the time it takes to see a slow down of the growth rate of Doxytreated cells in comparison with non-treated cells (S3A Fig (Division times of single or combined flc mutants)). When the cells were grown with Doxy in the absence of 1.4 M sorbitol, [3H]-C16:0 incorporation into GPLs and sphingolipids in 123ty cells was very low (Fig 4A). (Sphingolipids are the only polar lipids remaining after NaOH treatment). When grown in sorbitol, the synthesis rate of GPLs was brought back, although not to WT levels (Fig 4B). This difference could not be attributed to a difference in cell viability since colony forming units (CFU) after 16 h of culture on Doxy with and without sorbitol was the same (39 and 41 , respectively, compared to cells not treated with Doxy). In spite of reduced viability by this criterion, all cells still retained a full redox potential (see below). Differently from GPLs, sphingolipid biosynthesis remained inefficient in Doxy treated 123ty cells even on sorbitol, both ifPLOS Genetics | DOI:10.1371/journal.pgen.July 27,7 /Yeast E-MAP for Identification of Membrane Transporters Operating Lipid Flip FlopFig 4. Lipid biosynthesis of 123ty mutants assessed by metabolic labeling. (A ) WT or 123ty cells incubated with or without 10 g/ml Doxy for the indicated times in YPD (A) or YPD + 1.4 M sorbitol (B), were radiolabeled with [3H]-C16:0 for the indicated times at 30 , the lipids were extracted, treated with NaOH as indicated, spotted and separated by TLC using solvent 1. (C) same as in (B) but additional 25 M of cold C16:0 were added during labeling and lipids were separated by TLC with solvent 2. (D) cells grown with or without 10 g/ml Doxy for 16 h in inositol-free SC + 1.4 M sorbitol were labeled with [3H]-myo-inositol for 2 h and the lipids from 10 OD600 of each cell type were processed as in (C). NL = neutral lipids are free FAs, DAG, TAG, ergosterol esters and (acyl-)ceramides. doi:10.1371/journal.pgen.1006160.g[3H]-C16:0 or [3H]-myo-inositol was used to label cells (Fig 4C and 4D). In Doxy treated 123ty mutants, the incorporation of [3H]-myo-inositol tended to remain in the form of phosphatidylinositol (PI) (Fig 4D). Accumulation of PI is expected when ceramides are not made in sufficient quantity since most PI is normally consumed by Aur1-Kei1 transferring inositol-phosphate from PI to ceramides thus generating inositolphosphorylceramides. Three possible reasons for the reduction of the lipid biosynthesis rate in Doxy treated 123ty mutants came to our mind: 1) The proposed lack of FAD [30] would lead to a severe dysfunction of Ero1 and Pdi1 and a lack of proper oxidative folding of some ER proteins, also affecting enzymes involved in lipid biosynthesis [35]. 2) The reduced activity of the lipid biosynthetic enzymes would be related to the growth arrest the cells undergo when incubated with Doxy and 3) The flc mutants would indeed have a defect in flipping acyl-CoA or GPLs from the cytosol into the lumen of the ER. To get evidence for a flippase defect in flc mutants, we measured the acyl transferase activity of microsomes in presence of very low concentrations of 16:0-CoA hoping that low concentrations of acyl-CoA would make the PA synthesis more dependent on flippa.

‘ coordinate is the percentage of roles (s)he accepted for each

‘ coordinate is the percentage of roles (s)he accepted for each category. Scatterplots are for (a) ordinary favorable roles, (b) extraordinary favorable roles, (c) ordinary unfavorable roles, and (d) extraordinary unfavorable roles. SPQ, schizotypal personality questionnaire.** ** * ** * ** **Reaction Times (ms)Percentage of accepted roles70 60 50 40 30 20 101180 1160 1140 1120 1100 1080 1060 1040 1020 1000 980 960 940 920**Ordinary FavorableOrdinary Extraordinary Unfavorable Favorable Category combinations High SPQ scorersExtraordinary UnfavorableOrdinary FavorableExtraordinary Ordinary Favorable Unfavorable Category combinations High extraordinary role acceptersExtraordinary UnfavorableLow SPQ scorersLow extraordinary role acceptersAcceptanceRejectionFigure 2. Percentages of social roles accepted in each category for high- and low-SPQ scorers and standard errors (vertical bars) for the 203 participants. *P o0.05, **P o0.0001. SPQ, schizotypal personality questionnaire.Figure 3. Mean reaction times and standard errors (vertical bars) for accepted (plain rectangles) and rejected (crosshatched rectangles) social roles for high and low extraordinary roles accepters. *Po 0.05.(i.e., bizarre behavior, thought disorders, unusual thoughts, poor insight, and difficulty in abstract thinking).16 In accordance with that view, the multiple regression suggested that the tendency to accept ordinary favorable roles had some protective Ensartinib supplier effect againstnpj Schizophrenia (2016)schizotypal traits. Across all the categories, individuals with higher SPQ scores accepted more social roles than those with lower scores. All these results are reminiscent of the numerous anecdotes, so often published in the media, about thePublished in partnership with the Schizophrenia International Research SocietyExtraordinary roles and schizotypy AL Fernandez-Cruz et al5 disorganization of famous artists and the extraordinary roles they perform in society, now and in the past.17 On the other hand, works, such as the study of Twomey et al.,18 link psychoticism to openness to experience, sensation-seeking and creativity. Similarly, it was observed that, among writers and actors, scores for psychoticism were higher than among less `creative’ individuals19 and Andreasen noted in 1996 (ref. 20) that highly creative people had higher scores on measures of psychopathology than less creative people. In our case, this is akin to individuals who accept a lesser percentage of extraordinary social roles having lower SPQ scores. Further supporting the drive hypothesis, high accepters of extraordinary roles appeared `more enthusiast’ at accepting roles and more reluctant at MK-8742MedChemExpress Elbasvir rejecting them as they took less times for acceptances and more times for rejections than low accepters. This could be related to a higher baseline level of activation of the brain representations of these roles in the participants with higher SPQ scores. These results were obtained in a sample of the general population. Given the low frequency of schizotypy and of schizophrenia in that population, it is highly unlikely that those who accepted more extraordinary roles did it as a consequence of some pre-existing schizophrenia factors. One could eliminate an effect of the cognitive deficits found in the continuum going from normality to schizophrenia via schizotypy.9?3,21 In the task, these deficits would have induced longer reaction times for those who accepted more extraordinary roles or for the subgroup with higher SPQ.’ coordinate is the percentage of roles (s)he accepted for each category. Scatterplots are for (a) ordinary favorable roles, (b) extraordinary favorable roles, (c) ordinary unfavorable roles, and (d) extraordinary unfavorable roles. SPQ, schizotypal personality questionnaire.** ** * ** * ** **Reaction Times (ms)Percentage of accepted roles70 60 50 40 30 20 101180 1160 1140 1120 1100 1080 1060 1040 1020 1000 980 960 940 920**Ordinary FavorableOrdinary Extraordinary Unfavorable Favorable Category combinations High SPQ scorersExtraordinary UnfavorableOrdinary FavorableExtraordinary Ordinary Favorable Unfavorable Category combinations High extraordinary role acceptersExtraordinary UnfavorableLow SPQ scorersLow extraordinary role acceptersAcceptanceRejectionFigure 2. Percentages of social roles accepted in each category for high- and low-SPQ scorers and standard errors (vertical bars) for the 203 participants. *P o0.05, **P o0.0001. SPQ, schizotypal personality questionnaire.Figure 3. Mean reaction times and standard errors (vertical bars) for accepted (plain rectangles) and rejected (crosshatched rectangles) social roles for high and low extraordinary roles accepters. *Po 0.05.(i.e., bizarre behavior, thought disorders, unusual thoughts, poor insight, and difficulty in abstract thinking).16 In accordance with that view, the multiple regression suggested that the tendency to accept ordinary favorable roles had some protective effect againstnpj Schizophrenia (2016)schizotypal traits. Across all the categories, individuals with higher SPQ scores accepted more social roles than those with lower scores. All these results are reminiscent of the numerous anecdotes, so often published in the media, about thePublished in partnership with the Schizophrenia International Research SocietyExtraordinary roles and schizotypy AL Fernandez-Cruz et al5 disorganization of famous artists and the extraordinary roles they perform in society, now and in the past.17 On the other hand, works, such as the study of Twomey et al.,18 link psychoticism to openness to experience, sensation-seeking and creativity. Similarly, it was observed that, among writers and actors, scores for psychoticism were higher than among less `creative’ individuals19 and Andreasen noted in 1996 (ref. 20) that highly creative people had higher scores on measures of psychopathology than less creative people. In our case, this is akin to individuals who accept a lesser percentage of extraordinary social roles having lower SPQ scores. Further supporting the drive hypothesis, high accepters of extraordinary roles appeared `more enthusiast’ at accepting roles and more reluctant at rejecting them as they took less times for acceptances and more times for rejections than low accepters. This could be related to a higher baseline level of activation of the brain representations of these roles in the participants with higher SPQ scores. These results were obtained in a sample of the general population. Given the low frequency of schizotypy and of schizophrenia in that population, it is highly unlikely that those who accepted more extraordinary roles did it as a consequence of some pre-existing schizophrenia factors. One could eliminate an effect of the cognitive deficits found in the continuum going from normality to schizophrenia via schizotypy.9?3,21 In the task, these deficits would have induced longer reaction times for those who accepted more extraordinary roles or for the subgroup with higher SPQ.

Ose seen in the control rats. Altogether, these findings suggest that

Ose seen in the control rats. Altogether, these findings suggest that RAS OPC-8212MedChemExpress Vesnarinone blockade and ETS-1 blockade alone improve GIS in hypertensive DS rats; however, only concomitant RAS and ETS-1 blockade had a significant effect on interstitial fibrosis. ETS-1 Blockade Reduces Urinary TGF- and Cortical Fibronectin Expression To better assess the role of ETS-1 blockade alone or in combination with RAS blockade on renal injury, we determined their effects on cortical fibronectin expression and on urinary excretion of TGF-. As shown in Figure 5, hypertensive DS rats had a significant increase in the cortical expression of fibronectin compared with normotensive DS rats. Treatment with DN, but not with MU, peptide normalized fibronectin expression as assessed by Western blot. Treatment with ARB, however, had no significant effect on fibronectin, whereas concomitant RAS and ETS-1 blockade had similar effects to ETS-1 blockade alone. To determine whether these changes in fibronectin expression were linked to changes in TGF- production, a critical growth factor implicated in the pathogenesis of renal fibrosis, we 24 measured the urinary excretion of TGF- as we have and others have previously described. As shown in Table, hypertensive DS rats had significantly higher urinary excretion of TGF- compared with normotensive DS rats. The administration of DN peptide resulted in significant reductions in the urinary excretion of TGF- while treatment with the MU peptide had no effect. Treatment with ARB alone had no effect, whereas the combination of DN/ARB completely normalized the urinary excretion of TGF- in hypertensive DS rats. ETS-1 Blockade Reduces Macrophage Infiltration in Hypertensive DS rats Given the well-known role of inflammation as mediator of the effects of renal injury in 25 hypertensive DS rats, ,26 we determined the effects of ETS-1 blockade alone or in combination with RAS blockade on macrophage infiltration. As shown in Figure 6, we observed a significant increase in macrophage infiltration in hypertensive DS rats that was more evident in periglomerular areas and the cortical interstitium. Treatment with DN normalized the number of macrophages infiltrating the cortex of hypertensive DS rats while the MU peptide had no effect. Treatment with ARB had a modest albeit significant effect on macrophage infiltration while dual ETS-1 and RAS blockade reduced macrophage infiltration to levels similar to those of control rats on low-salt diet.Hypertension. Author manuscript; available in PMC 2016 June 08.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptFeng et al.PageEffects of ETS-1 Blockade on Components of the RASAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptTo determine the effects of ETS 1 on specific components of the RAS, we determined the effects of ETS 1 blockade on the cortical concentrations of Ang II and the urinary excretion of angiotensinogen. As shown in the Table, hypertensive DS rats on a high-salt diet had a significant increase in the urinary excretion of angiotensinogen that was significantly reduced by ETS 1 blockade and ARB and normalized by the combination of ETS-1 and RAS blockade. Hypertensive DS rats had purchase AZD4547 increased cortical expression of Ang II that was partially reduced by DN, MU, ARB, and concomitant ETS-1 and RAS blockade.DiscussionETS-1 is a member of the ETS family of transcription factors that share a highly conserved 6 DNA-binding domain (ETS domain) that originates from the.Ose seen in the control rats. Altogether, these findings suggest that RAS blockade and ETS-1 blockade alone improve GIS in hypertensive DS rats; however, only concomitant RAS and ETS-1 blockade had a significant effect on interstitial fibrosis. ETS-1 Blockade Reduces Urinary TGF- and Cortical Fibronectin Expression To better assess the role of ETS-1 blockade alone or in combination with RAS blockade on renal injury, we determined their effects on cortical fibronectin expression and on urinary excretion of TGF-. As shown in Figure 5, hypertensive DS rats had a significant increase in the cortical expression of fibronectin compared with normotensive DS rats. Treatment with DN, but not with MU, peptide normalized fibronectin expression as assessed by Western blot. Treatment with ARB, however, had no significant effect on fibronectin, whereas concomitant RAS and ETS-1 blockade had similar effects to ETS-1 blockade alone. To determine whether these changes in fibronectin expression were linked to changes in TGF- production, a critical growth factor implicated in the pathogenesis of renal fibrosis, we 24 measured the urinary excretion of TGF- as we have and others have previously described. As shown in Table, hypertensive DS rats had significantly higher urinary excretion of TGF- compared with normotensive DS rats. The administration of DN peptide resulted in significant reductions in the urinary excretion of TGF- while treatment with the MU peptide had no effect. Treatment with ARB alone had no effect, whereas the combination of DN/ARB completely normalized the urinary excretion of TGF- in hypertensive DS rats. ETS-1 Blockade Reduces Macrophage Infiltration in Hypertensive DS rats Given the well-known role of inflammation as mediator of the effects of renal injury in 25 hypertensive DS rats, ,26 we determined the effects of ETS-1 blockade alone or in combination with RAS blockade on macrophage infiltration. As shown in Figure 6, we observed a significant increase in macrophage infiltration in hypertensive DS rats that was more evident in periglomerular areas and the cortical interstitium. Treatment with DN normalized the number of macrophages infiltrating the cortex of hypertensive DS rats while the MU peptide had no effect. Treatment with ARB had a modest albeit significant effect on macrophage infiltration while dual ETS-1 and RAS blockade reduced macrophage infiltration to levels similar to those of control rats on low-salt diet.Hypertension. Author manuscript; available in PMC 2016 June 08.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptFeng et al.PageEffects of ETS-1 Blockade on Components of the RASAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptTo determine the effects of ETS 1 on specific components of the RAS, we determined the effects of ETS 1 blockade on the cortical concentrations of Ang II and the urinary excretion of angiotensinogen. As shown in the Table, hypertensive DS rats on a high-salt diet had a significant increase in the urinary excretion of angiotensinogen that was significantly reduced by ETS 1 blockade and ARB and normalized by the combination of ETS-1 and RAS blockade. Hypertensive DS rats had increased cortical expression of Ang II that was partially reduced by DN, MU, ARB, and concomitant ETS-1 and RAS blockade.DiscussionETS-1 is a member of the ETS family of transcription factors that share a highly conserved 6 DNA-binding domain (ETS domain) that originates from the.

To capture qualitative and mixed-methods studies. No time period was set.

To capture ML390MedChemExpress ML390 qualitative and mixed-methods studies. No time period was set. In addition, grey literature and secondary?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?H Mijovic et al.references were searched. Due to difficulties with conducting detailed content analysis in multiple languages, only English language studies were considered, which may have excluded studies from Francophone and Lusophone countries. The full literature search strategy is available in Appendix Table A1. The research was approved by the London School of Hygiene ethics committee. Inclusion criteria:search process is summarised in the PRISMA Flow chart in Fig. 1.Quality appraisalNumerous appraisal tools have been developed for qualitative studies (Thomas Harden 2008, Hannes 2011). We used the Critical Appraisal Skills Program (CASP) quality assessment tool (CASP UK 2013) with some modifications made to reflect the character of studies under review. Modified CASP criteria have been used frequently in qualitative reviews of health interventions, including a review of task delegation to lay health workers by the Cochrane Collaboration (Glenton et al. 2013), which we referred to in order to modify our checklist. Quality appraisal based on a modified CASP checklist is provided in Table 1. The amount of qualitative data available was limited by the fact that most studies were relatively brief and relied primarily on one-time interviews and focus group discussions (FGDs). Most of the studies did not employ additional qualitative methods such as serial indepth interviews, field observations or examining documents produced by health workers. Nevertheless, a number of studies provided rather ML390 dose diverse data, accounting not only for commonly expressed views but also for contradictory perspectives and opinions conveyed by the informants. Although all the studies detailed their recruitment strategy, none of the studies fully accounted for informants who refused to participate or explored how informant selection influenced study findings. Many studies explicitly stated that the study research was conducted as part of a task-shifting programme evaluation, but most researchers did not reflect???Qualitative or mixed-methods studies conducted in subSaharan Africa. Formal and informal task-shifting interventions in healthcare involving delegation of tasks from one cadre of health workers to another cadre. Studies providing primary, qualitative data regarding experiences with task-shifting interventions by national policy makers, health managers, health workers and/or healthcare recipients. Exclusion criteria: Nonprimary data (i.e. policy briefs, opinions, progress reports, systematic reviews). Mixed-methods studies where the qualitative component was deemed insufficient to contribute to further analysis. Studies focusing on task shifting of a very specific intervention rather than a broader set of tasks (i.e. initiation of antiretroviral therapy only, rather than management of HIV patients).???Search outcomeFrom 230 studies identified, 13 studies met the inclusion criteria and were included in the review. The literatureFigure 1 PRISMA flow chart.?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?Review Table 1 Quality appraisal checklist (CASP) Appraisal criteria 1 Is this study based on qualitative, narrative research?*Review: Task shifting i.To capture qualitative and mixed-methods studies. No time period was set. In addition, grey literature and secondary?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?H Mijovic et al.references were searched. Due to difficulties with conducting detailed content analysis in multiple languages, only English language studies were considered, which may have excluded studies from Francophone and Lusophone countries. The full literature search strategy is available in Appendix Table A1. The research was approved by the London School of Hygiene ethics committee. Inclusion criteria:search process is summarised in the PRISMA Flow chart in Fig. 1.Quality appraisalNumerous appraisal tools have been developed for qualitative studies (Thomas Harden 2008, Hannes 2011). We used the Critical Appraisal Skills Program (CASP) quality assessment tool (CASP UK 2013) with some modifications made to reflect the character of studies under review. Modified CASP criteria have been used frequently in qualitative reviews of health interventions, including a review of task delegation to lay health workers by the Cochrane Collaboration (Glenton et al. 2013), which we referred to in order to modify our checklist. Quality appraisal based on a modified CASP checklist is provided in Table 1. The amount of qualitative data available was limited by the fact that most studies were relatively brief and relied primarily on one-time interviews and focus group discussions (FGDs). Most of the studies did not employ additional qualitative methods such as serial indepth interviews, field observations or examining documents produced by health workers. Nevertheless, a number of studies provided rather diverse data, accounting not only for commonly expressed views but also for contradictory perspectives and opinions conveyed by the informants. Although all the studies detailed their recruitment strategy, none of the studies fully accounted for informants who refused to participate or explored how informant selection influenced study findings. Many studies explicitly stated that the study research was conducted as part of a task-shifting programme evaluation, but most researchers did not reflect???Qualitative or mixed-methods studies conducted in subSaharan Africa. Formal and informal task-shifting interventions in healthcare involving delegation of tasks from one cadre of health workers to another cadre. Studies providing primary, qualitative data regarding experiences with task-shifting interventions by national policy makers, health managers, health workers and/or healthcare recipients. Exclusion criteria: Nonprimary data (i.e. policy briefs, opinions, progress reports, systematic reviews). Mixed-methods studies where the qualitative component was deemed insufficient to contribute to further analysis. Studies focusing on task shifting of a very specific intervention rather than a broader set of tasks (i.e. initiation of antiretroviral therapy only, rather than management of HIV patients).???Search outcomeFrom 230 studies identified, 13 studies met the inclusion criteria and were included in the review. The literatureFigure 1 PRISMA flow chart.?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?Review Table 1 Quality appraisal checklist (CASP) Appraisal criteria 1 Is this study based on qualitative, narrative research?*Review: Task shifting i.

Potential [E?(ArOH?/0)] give these molecules a strong preference to react

Potential [E?(ArOH?/0)] give these molecules a strong preference to react by concerted transfer of e- and H+ (HAT). Njus and Kelley used such reasoning to GGTI298 msds conclude that Vitamin E donates H?as opposed to e- in biological reactions.135 A characteristic of these and other systems that prefer to transfer H?rather than react by stepwise paths (cf., TEMPOH above) is the very large shift of the pKa upon redox change and (equivalently) the large shift of E?upon protonation: for -tocopherol, the pKa changes by 25 units and E?changes by 1.5 V. 5.2.5 Quinones, Hydroquinones and Catechols–The PCET chemistry of hydroquinones and catechols (1,4- and 1,2-dihydroxybenzenes, respectively) is somewhat similar to that of 4-substituted phenols, but more extensive because there are two transferable hydrogen atoms and removal of both leads to stable quinones. This means that instead of the four species of the standard `square scheme’ that are formed upon PT, ET, or CPET from HX (Scheme 4), there are nine species derived from H2Q, as shown in Figure 2. This is also the case for flavins, which are discussed below. In practice, the cationic forms, H2Q?, H2Q2+ and HQ+, are not involved in typical PCET reactivity because they are high energy species under normal conditions. In the reactions of the first O bond, hydroquinones follow the patterns outlined above for phenols. In general, the pKa values for H2Q and the oxidation potential of HQ- fit on Hammett correlations with other 4-substituted phenols, both in aqueous117 and in organic media.116 For example, the BDFE of the first O bond in hydroquinone is 2? kcal mol-1 weaker than that of p-methoxyphenol. With hydroquinones and catechols, however, loss of H?yields the semiquinone radical that has a high propensity to lose a second H?148 Semiquinones and related species were among the first free radicals to be investigated RR6 chemical information inChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagedetail: Michaelis’ 1935 review in this journal points out that many systems commonly understood as 1e- systems can actually undergo 1e- or 1H+/1e- redox chemistry, and that the redox properties of semiquinone-type radicals are dependent upon pH ?a very early recognition of the importance of PCET in biology.149 While hydroquinones have reactivity patterns that are in part similar to phenols, with preferential loss of H? quinones have a different PCET behavior, especially in water. Quinones are typically easily reduced to semiquinone radical anions in water, without the assistance of protons, and the Q? anions are not particularly basic (Table 6). Therefore quinone cofactors can readily mediate stepwise PCET reactions, with initial electron transfer followed by proton transfer. Q/Q? interconversion is well understood using semi-classical ET theory.150 Such stepwise mechanisms have been discussed,151 and an example of stepwise PT-ET of quinones in biology is discussed in Section 6 below. The aqueous 2H+/2e- potentials of many quinones have been reported, because they are easily measured and because they are important biological cofactors (ubiquinone, for instance, is so named because it is ubiquitous). Their electrochemistry is generally well behaved,153 although there is still much to be learned in this area.154 The electrochemical data directly give an average BDFE/BDE for each quinone system (Table 5). Interestingly, the average bond strength for most quinones lies between the relatively narrow range of 68 to 75.Potential [E?(ArOH?/0)] give these molecules a strong preference to react by concerted transfer of e- and H+ (HAT). Njus and Kelley used such reasoning to conclude that Vitamin E donates H?as opposed to e- in biological reactions.135 A characteristic of these and other systems that prefer to transfer H?rather than react by stepwise paths (cf., TEMPOH above) is the very large shift of the pKa upon redox change and (equivalently) the large shift of E?upon protonation: for -tocopherol, the pKa changes by 25 units and E?changes by 1.5 V. 5.2.5 Quinones, Hydroquinones and Catechols–The PCET chemistry of hydroquinones and catechols (1,4- and 1,2-dihydroxybenzenes, respectively) is somewhat similar to that of 4-substituted phenols, but more extensive because there are two transferable hydrogen atoms and removal of both leads to stable quinones. This means that instead of the four species of the standard `square scheme’ that are formed upon PT, ET, or CPET from HX (Scheme 4), there are nine species derived from H2Q, as shown in Figure 2. This is also the case for flavins, which are discussed below. In practice, the cationic forms, H2Q?, H2Q2+ and HQ+, are not involved in typical PCET reactivity because they are high energy species under normal conditions. In the reactions of the first O bond, hydroquinones follow the patterns outlined above for phenols. In general, the pKa values for H2Q and the oxidation potential of HQ- fit on Hammett correlations with other 4-substituted phenols, both in aqueous117 and in organic media.116 For example, the BDFE of the first O bond in hydroquinone is 2? kcal mol-1 weaker than that of p-methoxyphenol. With hydroquinones and catechols, however, loss of H?yields the semiquinone radical that has a high propensity to lose a second H?148 Semiquinones and related species were among the first free radicals to be investigated inChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagedetail: Michaelis’ 1935 review in this journal points out that many systems commonly understood as 1e- systems can actually undergo 1e- or 1H+/1e- redox chemistry, and that the redox properties of semiquinone-type radicals are dependent upon pH ?a very early recognition of the importance of PCET in biology.149 While hydroquinones have reactivity patterns that are in part similar to phenols, with preferential loss of H? quinones have a different PCET behavior, especially in water. Quinones are typically easily reduced to semiquinone radical anions in water, without the assistance of protons, and the Q? anions are not particularly basic (Table 6). Therefore quinone cofactors can readily mediate stepwise PCET reactions, with initial electron transfer followed by proton transfer. Q/Q? interconversion is well understood using semi-classical ET theory.150 Such stepwise mechanisms have been discussed,151 and an example of stepwise PT-ET of quinones in biology is discussed in Section 6 below. The aqueous 2H+/2e- potentials of many quinones have been reported, because they are easily measured and because they are important biological cofactors (ubiquinone, for instance, is so named because it is ubiquitous). Their electrochemistry is generally well behaved,153 although there is still much to be learned in this area.154 The electrochemical data directly give an average BDFE/BDE for each quinone system (Table 5). Interestingly, the average bond strength for most quinones lies between the relatively narrow range of 68 to 75.

Axonomy of learning aims, avoids assessment that rests on low ability.

Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may buy INK1117 integrate it in their instructional practice. They can use the list of broader Saroglitazar Magnesium web opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.

R. PDIA4 is reported to be associated with chemo resistance53 SPARC

R. PDIA4 is reported to be associated with chemo resistance53 SPARC is reported to have role in cancer progression;54 Protein S100A10 is reported to have role in cell proliferation;55 SERPINA1 and ITGB1 are reported to play role in invasion and migration56,57. We believe this high confidence list of proteins with their proteotypic peptides would serve as a protein/peptide resource for further investigation by us and others in the community for tumor recurrence in a follow-up study cohort of patients diagnosed and treated for grade II tumors.Differential proteins as potential surveillance markers for targeted investigation for recurrence. DAs have a long median survival but invariably recur. After treatment, they may recur as Gr II or higherConclusionsWe have identified 340 high confidence differentially expressed proteins with high resolution mass spectrometry, from the microsomal fraction of low-grade (Grade II) glioma – diffuse astrocytoma. mTOR activation, increase in ribosome biogenesis and protein translation were found to be major processes altered in these tumors; PI3Kc/Scientific RepoRts | 6:26882 | DOI: 10.1038/srepwww.nature.com/EPZ004777 site scientificreports/Fold change 4.01 2.52 2.19 2.66 2.18 3.76 2.25 2.04 2.01 2.01 2.77 2.91 2.29 2.43 2.36 3.20 2.34 4.62 3.13 2.37 2.24 3.15 2.97 2.75 2.47 2.45 2.17 2.81 2.22 Signal peptide + + + + + + + + + + + + + + + + + + + + + + + – + + + + + TM domain – – + – + – – + – – – – – – – + + – – + + – – + – – + – – + + + + + + + + + + + + + + + + + + + + + + + – + + Exocarta database + +Gene symbol ANXA5 APOE BCAN CALR CANX CD14 CP EGFR ERAP1 FN1 GSN HP HPX HSP90B1 HSPA5 ITGA6 ITGB1 ITIH2 LGALS3BP LMAN2 NUCB2 PDIA4 PPIB S100A10 SERPINA1 SPARC TMED4 TNC TPPProtein name Annexin A5 Apolipoprotein E brevican core protein isoform 1 precursor Calreticulin Calnexin CD14 antigen Ceruloplasmin Epidermal growth factor receptor isoform a Endoplasmic reticulum aminopeptidase 1 isoform b Fibronectin 1 isoform 6 Gelsolin isoform b Haptoglobin isoform 1 Hemopexin Endoplasmin 78 kda glucose-regulated protein Integrin alpha-6 isoform b Integrin beta-1 isoform 1A Inter-alpha globulin inhibitor H2 polypeptide Galectin-3-binding protein Vesicular integral-membrane protein VIP36 Nucleobindin-2 Protein CyaneinMedChemExpress Synergisidin disulfide-isomerase A4 Peptidylprolyl isomerase B Protein S100-A10 Serine proteinase inhibitor, clade A, member 1 Sparc Transmembrane emp24 domaincontaining protein 4 Tenascin Tripeptidyl-peptidasePeptides 10 7 6 11 11 3 6 7 6 4 10 10 6 14 18 3 3 2 4 4 4 9 7 2 11 5 3 9CSF + + + + – + + + + + + + + + + – + + + + – – + – + + + – +Plasma + ++ + + + + + – + + + + + + + + + + + + + + + + – + +Table 1. A list of Candidate proteins with secretory potential observed in DA, for post-treatment surveillance. The proteins were selected from Supplementary Table S6 on the basis of their upregulated expression and relevance to the cancer. The proteotypic peptides of these proteins are given in Supplementary Table S6 and may be useful for their targeted analysis in patient samples.mTOR pathway is also implicated in the large study carried out by TCGA. Differentially expressed proteins in this early stage, low-grade gliomas, include important regulatory proteins such as EGFR, HNRNP K and BCAN. Though not specific to DA they may be promising candidates for confirmatory diagnosis of these early stage tumors. We also provide a catalogue of differentially expressed proteins in Gr II and Gr III with secretory potential along with their proteotypic.R. PDIA4 is reported to be associated with chemo resistance53 SPARC is reported to have role in cancer progression;54 Protein S100A10 is reported to have role in cell proliferation;55 SERPINA1 and ITGB1 are reported to play role in invasion and migration56,57. We believe this high confidence list of proteins with their proteotypic peptides would serve as a protein/peptide resource for further investigation by us and others in the community for tumor recurrence in a follow-up study cohort of patients diagnosed and treated for grade II tumors.Differential proteins as potential surveillance markers for targeted investigation for recurrence. DAs have a long median survival but invariably recur. After treatment, they may recur as Gr II or higherConclusionsWe have identified 340 high confidence differentially expressed proteins with high resolution mass spectrometry, from the microsomal fraction of low-grade (Grade II) glioma – diffuse astrocytoma. mTOR activation, increase in ribosome biogenesis and protein translation were found to be major processes altered in these tumors; PI3Kc/Scientific RepoRts | 6:26882 | DOI: 10.1038/srepwww.nature.com/scientificreports/Fold change 4.01 2.52 2.19 2.66 2.18 3.76 2.25 2.04 2.01 2.01 2.77 2.91 2.29 2.43 2.36 3.20 2.34 4.62 3.13 2.37 2.24 3.15 2.97 2.75 2.47 2.45 2.17 2.81 2.22 Signal peptide + + + + + + + + + + + + + + + + + + + + + + + – + + + + + TM domain – – + – + – – + – – – – – – – + + – – + + – – + – – + – – + + + + + + + + + + + + + + + + + + + + + + + – + + Exocarta database + +Gene symbol ANXA5 APOE BCAN CALR CANX CD14 CP EGFR ERAP1 FN1 GSN HP HPX HSP90B1 HSPA5 ITGA6 ITGB1 ITIH2 LGALS3BP LMAN2 NUCB2 PDIA4 PPIB S100A10 SERPINA1 SPARC TMED4 TNC TPPProtein name Annexin A5 Apolipoprotein E brevican core protein isoform 1 precursor Calreticulin Calnexin CD14 antigen Ceruloplasmin Epidermal growth factor receptor isoform a Endoplasmic reticulum aminopeptidase 1 isoform b Fibronectin 1 isoform 6 Gelsolin isoform b Haptoglobin isoform 1 Hemopexin Endoplasmin 78 kda glucose-regulated protein Integrin alpha-6 isoform b Integrin beta-1 isoform 1A Inter-alpha globulin inhibitor H2 polypeptide Galectin-3-binding protein Vesicular integral-membrane protein VIP36 Nucleobindin-2 Protein disulfide-isomerase A4 Peptidylprolyl isomerase B Protein S100-A10 Serine proteinase inhibitor, clade A, member 1 Sparc Transmembrane emp24 domaincontaining protein 4 Tenascin Tripeptidyl-peptidasePeptides 10 7 6 11 11 3 6 7 6 4 10 10 6 14 18 3 3 2 4 4 4 9 7 2 11 5 3 9CSF + + + + – + + + + + + + + + + – + + + + – – + – + + + – +Plasma + ++ + + + + + – + + + + + + + + + + + + + + + + – + +Table 1. A list of Candidate proteins with secretory potential observed in DA, for post-treatment surveillance. The proteins were selected from Supplementary Table S6 on the basis of their upregulated expression and relevance to the cancer. The proteotypic peptides of these proteins are given in Supplementary Table S6 and may be useful for their targeted analysis in patient samples.mTOR pathway is also implicated in the large study carried out by TCGA. Differentially expressed proteins in this early stage, low-grade gliomas, include important regulatory proteins such as EGFR, HNRNP K and BCAN. Though not specific to DA they may be promising candidates for confirmatory diagnosis of these early stage tumors. We also provide a catalogue of differentially expressed proteins in Gr II and Gr III with secretory potential along with their proteotypic.

/ml in 10 mM Tris-HCl, pH 7.5), DNaseI (140 U/ml in culture medium

/ml in 10 mM Tris-HCl, pH 7.5), DNaseI (140 U/ml in culture medium) or DspB (40 /ml in PBS). Control wells were treated with 100 of the appropriate buffer. Following enzymatic treatment, the wells were washed and stained as described above.RNA IsolationFor RNA isolation, biofilm cultures of S. aureus strains were grown in BD Falcon 6-well plates (BD Labware, Franklin Lakes, NJ). The plates were pre-coated with a 20 porcine plasma solution (2.5 ml per well) by overnight incubation at 4?C as described for the microtiter plate assay. Overnight cultures of all strains were diluted to an OD600 of 0.05 in fresh Losmapimod manufacturer TSB-GN and 2.5 ml was added to each well. For each experimental sample (PD150606 site biological replicate), 3 wells were used for each strain. ForPLOS ONE | www.plosone.orgSwine MRSA Isolates form Robust Biofilmseach strain, 2 samples were prepared. The plates were incubated statically for 24 hours at 37?C in a humidified incubator. The culture media was removed by aspiration and each well was washed 3 times with 3 ml sterile PBS to remove unattached bacteria. As obtaining RNA from biofilm samples can be difficult, a customized RNA extraction protocol based on chemical and mechanical lysis, organic extraction and silica membrane purification was developed and optimized for these samples, drawing from methods developed for RNA isolation from S. epidermidis biofilms [53,54]. After washing the biofilm cultures, 3 ml TRI Reagent Solution (Ambion, Carlsbad, CA) was added to each well of the 6-well plate and incubated for 15 minutes at room temperature. A cell scraper was used to ensure complete detachment of the biofilm from the plate surface and the mixture transferred to a 15 ml Falcon tube (BD Labware, Franklin Lakes, NJ) and mixed thoroughly. For each strain, biofilms in TRI Reagent from 3 wells were combined into one sample for subsequent RNA purification steps; 2 samples were obtained for each strain. At this point, samples were stored at -80?C prior to further processing. Next, 1 ml of the bacteria in TRI Reagent was added to a 2 ml screw-cap tube containing 0.5 g of acid-washed 0.25 mm carbide beads (MO BIO Laboratories, Carlsbad, CA) and heated to 60?C for 20 minutes with periodic mixing. This was followed by vortexing the samples for 20 minutes at maximum speed. The carbide beads were pelleted by centrifugation (10,000 x g, 1 minute) and the TRI Reagent lysate transferred to a 1.5 ml tube. Phase separation was performed by addition of 0.2 volumes chloroform and centrifugation at 12,000 x g for 15 minutes at 4?C. The aqueous phase was transferred to a new 1.5 ml tube and mixed with an equal volume of 95 ethanol. The Direct-zol RNA MiniPrep Kit (Zymo Research, Irvine, CA) was used according to the manufacturer’s instructions and total RNA was eluted in 25-50 RNase-free water. Concentration and purity of the total RNA was assessed by spectrophotometry using a NanoDrop 1000 (Thermo, Fisher Scientific, Wilmington, DE). Total RNA samples that were too dilute at this point were concentrated using the RNA Clean Concentrator-5 kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions and total RNA was eluted in 10 RNase-free water.Table 2. qPCR Primers used in this study.Target 16S rRNA icaA icaR nuc1 nucPrimer Name 16S-SARTfor 16S-SARTrev icaA-SARTfor icaA-SARTrev icaR-SARTfor icaR-SARTrev nuc1-SARTfor nuc1-SARTrev nuc2-SARTfor nuc2-SARTrevSequence GAGGGTGATCGGCCACACT ACTGCTGCCTCCCGTAGGA AATTGGCTGTATTAAGCGAAGTCA GAGTGAAG./ml in 10 mM Tris-HCl, pH 7.5), DNaseI (140 U/ml in culture medium) or DspB (40 /ml in PBS). Control wells were treated with 100 of the appropriate buffer. Following enzymatic treatment, the wells were washed and stained as described above.RNA IsolationFor RNA isolation, biofilm cultures of S. aureus strains were grown in BD Falcon 6-well plates (BD Labware, Franklin Lakes, NJ). The plates were pre-coated with a 20 porcine plasma solution (2.5 ml per well) by overnight incubation at 4?C as described for the microtiter plate assay. Overnight cultures of all strains were diluted to an OD600 of 0.05 in fresh TSB-GN and 2.5 ml was added to each well. For each experimental sample (biological replicate), 3 wells were used for each strain. ForPLOS ONE | www.plosone.orgSwine MRSA Isolates form Robust Biofilmseach strain, 2 samples were prepared. The plates were incubated statically for 24 hours at 37?C in a humidified incubator. The culture media was removed by aspiration and each well was washed 3 times with 3 ml sterile PBS to remove unattached bacteria. As obtaining RNA from biofilm samples can be difficult, a customized RNA extraction protocol based on chemical and mechanical lysis, organic extraction and silica membrane purification was developed and optimized for these samples, drawing from methods developed for RNA isolation from S. epidermidis biofilms [53,54]. After washing the biofilm cultures, 3 ml TRI Reagent Solution (Ambion, Carlsbad, CA) was added to each well of the 6-well plate and incubated for 15 minutes at room temperature. A cell scraper was used to ensure complete detachment of the biofilm from the plate surface and the mixture transferred to a 15 ml Falcon tube (BD Labware, Franklin Lakes, NJ) and mixed thoroughly. For each strain, biofilms in TRI Reagent from 3 wells were combined into one sample for subsequent RNA purification steps; 2 samples were obtained for each strain. At this point, samples were stored at -80?C prior to further processing. Next, 1 ml of the bacteria in TRI Reagent was added to a 2 ml screw-cap tube containing 0.5 g of acid-washed 0.25 mm carbide beads (MO BIO Laboratories, Carlsbad, CA) and heated to 60?C for 20 minutes with periodic mixing. This was followed by vortexing the samples for 20 minutes at maximum speed. The carbide beads were pelleted by centrifugation (10,000 x g, 1 minute) and the TRI Reagent lysate transferred to a 1.5 ml tube. Phase separation was performed by addition of 0.2 volumes chloroform and centrifugation at 12,000 x g for 15 minutes at 4?C. The aqueous phase was transferred to a new 1.5 ml tube and mixed with an equal volume of 95 ethanol. The Direct-zol RNA MiniPrep Kit (Zymo Research, Irvine, CA) was used according to the manufacturer’s instructions and total RNA was eluted in 25-50 RNase-free water. Concentration and purity of the total RNA was assessed by spectrophotometry using a NanoDrop 1000 (Thermo, Fisher Scientific, Wilmington, DE). Total RNA samples that were too dilute at this point were concentrated using the RNA Clean Concentrator-5 kit (Zymo Research, Irvine, CA) according to the manufacturer’s instructions and total RNA was eluted in 10 RNase-free water.Table 2. qPCR Primers used in this study.Target 16S rRNA icaA icaR nuc1 nucPrimer Name 16S-SARTfor 16S-SARTrev icaA-SARTfor icaA-SARTrev icaR-SARTfor icaR-SARTrev nuc1-SARTfor nuc1-SARTrev nuc2-SARTfor nuc2-SARTrevSequence GAGGGTGATCGGCCACACT ACTGCTGCCTCCCGTAGGA AATTGGCTGTATTAAGCGAAGTCA GAGTGAAG.

Ims to care for the children. Ntate Kapo’s ability to

Ims to care for the children. Ntate Kapo’s ability to secure care for 3-year-old Kotsi and his brother also relied on a claim about bridewealth; but again, the lack of care by the paternal kin was this maternal grandfather’s primary concern. Kotsi’s mother Avermectin B1a web returned home during her illness, and passed away in her father’s arms. Kotsi’s maternal grandfather, Ntate Kapo, was one of a small but growing group of male primary caregivers I encountered. He repeatedly commented on the motherly nature of his relationship with his grandsons, thus reinforcing the deeply embedded gendered nature of care. Ntate Kapo told me that Kotsi’s paternal relatives did not ‘follow the rules’ (latela LY317615MedChemExpress Enzastaurin litaelo) and did not ‘do Sesotho culture properly’ (ha a etsa meetlo ea Sesotho ka nepo), thus reinforcing the rules in order to legitimate his own actions. According to Ntate Kapo, Kotsi’s mother was not being cared for during her illness, so she returned home to her father. After a few months, the paternal grandparents came to take back the children.J R Anthropol Inst. Author manuscript; available in PMC 2015 April 08.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptBlockPageNtate Kapo said, ‘”The children of whom? Because you did not even pay bridewealth”. Because they did not even come [to the funeral] when their mother died. And they went back without anything … They would not take me to the court because they did not pay bridewealth’. Although most Basotho negotiate care without involving the courts, legal redress remains a possibility. Kotsi’s paternal grandparents could not make a legitimate legal or social claim for him and his brother because they failed to adhere to customary laws regarding marriage as well as care. Ntate Kapo told me that children may only live with their paternal relatives if bridewealth has been paid, despite the ambiguous role bridewealth currently plays in determining caregiving arrangements. In this way, he positioned himself as a strong enforcer of the rules of patrilocality, and then legitimated his status as caregiver by demonstrating how the paternal family did not follow these rules. ‘M’e Malefu’s case was similar to Ntate Kapo’s in many ways. She cared for her daughter’s two school-aged girls. Her daughter had been married, with the expectation that the ‘cows would follow’ (Iikhomo li tla latela); however, the family was unable to pay, so ‘M’e Malefu claimed they were not married. She also said that the in-laws were not caring for her daughter, and like the previous example, they failed to attend her funeral. However, unlike Ntate Kapo, she and her husband went to court to legalize their claim for the children, even though the paternal relatives sent a letter from their chief saying that ‘M’e Malefu could have the orphaned girls. I asked her why she took this legal precaution despite the paternal family’s apparent lack of interest in the children. She said: ‘We went to the court because we wanted things to be certified (pakahatsa). Not to agree only’. It is interesting that she repeatedly mentioned that bridewealth had not been paid –this being her legal claim to the children. Yet she also emphasized a lack of care on the part of the paternal family as her primary motivation for her legal actions. Despite the formal separation of Sesotho and government laws in Lesotho, ‘M’e Malefu used both customary and formal legal structures to achieve particular social ends. In this case, the legal claims reinforc.Ims to care for the children. Ntate Kapo’s ability to secure care for 3-year-old Kotsi and his brother also relied on a claim about bridewealth; but again, the lack of care by the paternal kin was this maternal grandfather’s primary concern. Kotsi’s mother returned home during her illness, and passed away in her father’s arms. Kotsi’s maternal grandfather, Ntate Kapo, was one of a small but growing group of male primary caregivers I encountered. He repeatedly commented on the motherly nature of his relationship with his grandsons, thus reinforcing the deeply embedded gendered nature of care. Ntate Kapo told me that Kotsi’s paternal relatives did not ‘follow the rules’ (latela litaelo) and did not ‘do Sesotho culture properly’ (ha a etsa meetlo ea Sesotho ka nepo), thus reinforcing the rules in order to legitimate his own actions. According to Ntate Kapo, Kotsi’s mother was not being cared for during her illness, so she returned home to her father. After a few months, the paternal grandparents came to take back the children.J R Anthropol Inst. Author manuscript; available in PMC 2015 April 08.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptBlockPageNtate Kapo said, ‘”The children of whom? Because you did not even pay bridewealth”. Because they did not even come [to the funeral] when their mother died. And they went back without anything … They would not take me to the court because they did not pay bridewealth’. Although most Basotho negotiate care without involving the courts, legal redress remains a possibility. Kotsi’s paternal grandparents could not make a legitimate legal or social claim for him and his brother because they failed to adhere to customary laws regarding marriage as well as care. Ntate Kapo told me that children may only live with their paternal relatives if bridewealth has been paid, despite the ambiguous role bridewealth currently plays in determining caregiving arrangements. In this way, he positioned himself as a strong enforcer of the rules of patrilocality, and then legitimated his status as caregiver by demonstrating how the paternal family did not follow these rules. ‘M’e Malefu’s case was similar to Ntate Kapo’s in many ways. She cared for her daughter’s two school-aged girls. Her daughter had been married, with the expectation that the ‘cows would follow’ (Iikhomo li tla latela); however, the family was unable to pay, so ‘M’e Malefu claimed they were not married. She also said that the in-laws were not caring for her daughter, and like the previous example, they failed to attend her funeral. However, unlike Ntate Kapo, she and her husband went to court to legalize their claim for the children, even though the paternal relatives sent a letter from their chief saying that ‘M’e Malefu could have the orphaned girls. I asked her why she took this legal precaution despite the paternal family’s apparent lack of interest in the children. She said: ‘We went to the court because we wanted things to be certified (pakahatsa). Not to agree only’. It is interesting that she repeatedly mentioned that bridewealth had not been paid –this being her legal claim to the children. Yet she also emphasized a lack of care on the part of the paternal family as her primary motivation for her legal actions. Despite the formal separation of Sesotho and government laws in Lesotho, ‘M’e Malefu used both customary and formal legal structures to achieve particular social ends. In this case, the legal claims reinforc.

Representatives of `health service consumers’ in Uganda were summarised as follows

Representatives of `health service consumers’ in Uganda were summarised as follows:Patients were reportedly uncomfortable and dissatisfied with being handled by low cadre health workers. They wanted to be handled by doctors. They felt bad on learning that the attending health worker was not a doctor. (Uganda, Study #1)Although tasks Dihexa solubility performed by lower skilled health workers were not always paid through formal mechanisms, some health workers found ways to `cash in’ on their tasks. A study among CHWs in Kenya alluded to volunteer, periurban workers who wished to `acquire skills to sell, because of hard economic times in the country’ (Study # 10). Surgical Assistants in Mozambique were known, at times, to be `obliged to ask for illicit charges’ because of low remuneration relative to the amount of work they performed (Cumbi et al. 2007). Anecdotally, training lay workers in the community in some cases also resulted in untrained individuals posing as health workers and charging for their services (Study # 2, 10, 11). Category 2 ?TS should not be initiated in a health system where existing solutions are available and affordable In certain settings task shifting was seen as a direct threat to job safety and future employment prospects for nurses and doctors. In Uganda (Study # 1, 5), where aIdeally, the views of health workers and policy makers would be triangulated with the views of patients themselves. In the studies reviewed, views of patients and?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?H Mijovic et al.considerable number of doctors and nurses were unemployed or working overseas, task shifting was perceived by some health professionals and policy makers primarily as a short-sighted, cost-saving strategy, effectively pushing established professionals out of the healthcare system.That [task shifting] is an anomaly Uganda cannot afford. As long as we need the professionals, and they are within the country, we should employ them . . . (Senior Manager, Uganda, Study # 5)they are already used to the living conditions of their localities. (District Level Informant, Tanzania, Study # 9)Studies in the review highlighted the tension between health workers assuming new tasks who expected adequate compensation for the work performed and the policy makers who commonly assumed that task shifting was a `cost saving’ strategy. This is an important insight for any taskshifting programme in Kenya that affects nurses. There are many thousands of unemployed nurses in Kenya, and the benefits and limitations of the introduction of a new cadre in neonatal care should be compared to the prospect of employing more nurses in this area. Category 3 ?TS interventions must allow for career planning of all affected cadres Higher skilled cadres, managers and policy makers frequently agreed that compensation of new, lower cadres and opportunities for career progression were buy Cyclopamine inadequate and could potentially compromise the long-term success of task-shifting programmes. The quotes below refer to the newly introduced cadres of M E Officers and Surgical Assistants respectively:They are watching their colleagues moving up the ladder! They are just in one place. Even the good ones . . . we are going to lose them if this trend continues. (Program Officer, Botswana, Study # 8) . . . An individual spends six years in school and continues to be considered mid-level [it’s unjust]. . . There is a huge gap.Representatives of `health service consumers’ in Uganda were summarised as follows:Patients were reportedly uncomfortable and dissatisfied with being handled by low cadre health workers. They wanted to be handled by doctors. They felt bad on learning that the attending health worker was not a doctor. (Uganda, Study #1)Although tasks performed by lower skilled health workers were not always paid through formal mechanisms, some health workers found ways to `cash in’ on their tasks. A study among CHWs in Kenya alluded to volunteer, periurban workers who wished to `acquire skills to sell, because of hard economic times in the country’ (Study # 10). Surgical Assistants in Mozambique were known, at times, to be `obliged to ask for illicit charges’ because of low remuneration relative to the amount of work they performed (Cumbi et al. 2007). Anecdotally, training lay workers in the community in some cases also resulted in untrained individuals posing as health workers and charging for their services (Study # 2, 10, 11). Category 2 ?TS should not be initiated in a health system where existing solutions are available and affordable In certain settings task shifting was seen as a direct threat to job safety and future employment prospects for nurses and doctors. In Uganda (Study # 1, 5), where aIdeally, the views of health workers and policy makers would be triangulated with the views of patients themselves. In the studies reviewed, views of patients and?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?H Mijovic et al.considerable number of doctors and nurses were unemployed or working overseas, task shifting was perceived by some health professionals and policy makers primarily as a short-sighted, cost-saving strategy, effectively pushing established professionals out of the healthcare system.That [task shifting] is an anomaly Uganda cannot afford. As long as we need the professionals, and they are within the country, we should employ them . . . (Senior Manager, Uganda, Study # 5)they are already used to the living conditions of their localities. (District Level Informant, Tanzania, Study # 9)Studies in the review highlighted the tension between health workers assuming new tasks who expected adequate compensation for the work performed and the policy makers who commonly assumed that task shifting was a `cost saving’ strategy. This is an important insight for any taskshifting programme in Kenya that affects nurses. There are many thousands of unemployed nurses in Kenya, and the benefits and limitations of the introduction of a new cadre in neonatal care should be compared to the prospect of employing more nurses in this area. Category 3 ?TS interventions must allow for career planning of all affected cadres Higher skilled cadres, managers and policy makers frequently agreed that compensation of new, lower cadres and opportunities for career progression were inadequate and could potentially compromise the long-term success of task-shifting programmes. The quotes below refer to the newly introduced cadres of M E Officers and Surgical Assistants respectively:They are watching their colleagues moving up the ladder! They are just in one place. Even the good ones . . . we are going to lose them if this trend continues. (Program Officer, Botswana, Study # 8) . . . An individual spends six years in school and continues to be considered mid-level [it’s unjust]. . . There is a huge gap.

, and carbohydrates, and have been implicated in various diseases and aging.

, and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an GGTI298 biological activity effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the HS-173 supplier tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low ARA290 custom synthesis overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. RR6 site because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic purchase Thonzonium (bromide) molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not Luteolin 7-O-��-D-glucoside web undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does., and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does., and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does., and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does., and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does., and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does.

, and carbohydrates, and have been implicated in various diseases and aging.

, and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the HS-173 supplier tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low ARA290 custom synthesis overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does., and carbohydrates, and have been implicated in various diseases and aging.203,207,208 Many of these species are highly reactive withChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pageorganic molecules, making it difficult to study their chemistry in non-aqueous solvents. However, the aqueous thermochemistry of oxygen species has been studied extensively, and has been reviewed by Sawyer209 and Afanas’ev.210 The properties of the species without an O bond have been summarized above; the PCET thermochemistry of the O bonded species are given in Table 9 and Figure 6. The Pourbaix diagram for water (Figure 6c) does not show most of the reactive oxygen species. This is because, other than H2O2 and HO2-, the ROS are not the most thermodynamically stable species at any point in the diagram, at any pH or redox potential. The standard (pH 0) potential for the 4 e-/4 H+ reduction of O2 is always given as 1.23 V (eq 17) but from some perspectives it can be better to think about O2 reduction or water oxidation as transferring hydrogen atoms. The free energy in these terms, following eqs 15 or 16 above, is given in eq 18 both for the full 4 e-/4 H+ process and per hydrogen atom, as an effective BDFE. Thus, oxidizing water to O2, requires a `system’ with an effective BDFE of greater than 86 kcal mol-1. Such a system could be a hydrogen atom abstracting reagent, or a combination of an oxidant and a base (Section 5.9 below). In photosystem II, the oxidizing equivalents pass through the tyrosine/tyrosyl radical couple which in aqueous solution has a BDFE of 87.8 kcal mol-1 from Table 4. While this BDFE could be different within the protein, it shows that the tyrosyl radical has just enough free energy to accomplish water oxidation and shows the remarkable catalytic activity of the oxygen evolving complex at low overpotential.(17)NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript(18)5.4.2 Dioxygen–While the overall proton-coupled reduction of O2 to water is quite favorable, transfer of the first electron is far less favorable. Dioxygen is a poor one-electron outer-sphere oxidant, with E?for reduction to superoxide (O2?) = -0.16 V vs. NHE in H2O.209 Superoxide is also not very basic (aqueous pKa = 4.9), so this combination of a low potential and low pKa means that HO2?(hydroperoxyl) has a very low O BDFE, 60.4 kcal mol-1 in water. Because of this low BDFE, O2 is not an effective H-atom abstractor (so the large majority of organic molecules are `air stable’). It should be emphasized that H-atom abstracting ability typically correlates with the X BDFE that an oxidant can form and does not correlate with the `radical character’.211 Thus, dioxygen is a triplet diradical but is quite unreactive toward HAT, while permanganate (MnO4-) with no unpaired spins is a reactive H-atom abstractor because it can form an O bond with a BDFE of 80.7 kcal mol-1 (Section 5.10). In contrast, oxene (O), a neutral triplet radical like O2, is a far more potent H-atom abstractor because of the high BDFE of , 106.9 kcal mol-1 (Table 8). 5.4.3 Superoxide/Hydroperoxyl–Superoxide radical anion (O2?) and its protonated form (the neutral perhydroxyl radical, HO2? are considered reactive oxygen species but do not undergo the chemistry typical of oxygen radicals.212 Superoxide generally does not act as a direct one electron oxidant due to the relatively high energy of the solvated peroxide dianion (O22-).213 Similarly, O2? does.

L loci with low recombination rates may exhibit many of the

L loci with low recombination rates may exhibit many of the features of positively selected genes, generating spurious signals in selective sweep scans. Given the intrinsic difficulties of interpreting selection mapping data, additional tools, such as genome-wide association studies based on high throughput genotyping or whole-genome sequencing data obtained from large reference populations, will be indispensable to uncover the biological meaning of selective sweep signatures.Relationship between variation at markers mapping to putative selective sweeps and productive specialization. The main goal of our study was to map selective sweeps related with the geneticEthics statement. Blood samples were collected from sheep by trained veterinarians in the context of sanitation campaigns and TAPI-2 chemical information parentage controls not directly related with our research project. In all instances, veterinarians followed standard procedures and relevant Spanish national guidelines to ensure an appropriate animal care. Nucleic acid purification and genotyping with the Ovine 50 K SNP BeadChip. Blood was extractedwith Vacutainer tubes from 141 sheep corresponding to the Segure (N = 12), Xisqueta (N = 25), RipollesaMaterials and MethodsScientific RepoRts | 6:27296 | DOI: 10.1038/srepwww.nature.com/scientificreports/(N = 23), Gallega (N = 25), Canaria de Pelo (N = 27), and Roja Mallorquina (N = 29) breeds. Leukocytes were purified from whole blood by carrying out several washing steps with TE buffer (Tris 10 mM, EDTA 1 mM, pH 8.0). In this way, a volume of TE was added to 500 l blood and this mixture was vortexed and centrifuged at 13,000 rpm for 30 seconds. This procedure was repeated until a clean white pellet was obtained. Next, the cell pellet was EPZ004777 msds resuspended in 200 l cell lysis buffer (50 mM KCl, 10 mM Tris, 0.5 Tween 20) with 10 l proteinase K (10 mg/ml) and incubated for 4 hours at 56 . One volume of phenol:chloroform:isoamyl alcohol (25:24:1) was added to the lysate, and the resulting mixture was vortexed and centrifuged at 13,000 rpm for 15 min. Subsequently, the aqueous upper layer was transferred to a fresh tube and 2 M NaCl (0.1 volumes) and absolute ethanol (2 volumes at -20 ) were added. After a centrifugation step at 13,000 rpm for 30 min., the supernatant was discarded and salt contamination was removed by performing a washing step with 500 l 70 ethanol. Finally, the DNA pellet was air-dried at room temperature, and resuspended in 50 l milli-Q water. Genomic DNA samples obtained in this way were typed for 54,241 SNPs with the Ovine 50 K SNP BeadChip following standard protocols (http://www.illumina.com). Moderate sample size and the low density of this genotyping platform may have limited to some extent the power of our experiment. However, this was the only high throughput SNP typing tool available at the time we initiated genotyping tasks. The GenomeStudio software (Illumina) was used to generate standard ped and map files as well as to perform sample and marker-based quality control measures (we considered a GenCall score cutoff of 0.15 and an average sample call rate of 99 ). Genotyping data generated in the current work were submitted to the International Sheep Genomics Consortium database (ISGC, http://www.sheephapmap.org) and they should be available upon request. Besides the 50 K data generated in our project for six ovine breeds from Spain, in the population structure and selection analyses we also used existing 50 K data from 229 sheep belon.L loci with low recombination rates may exhibit many of the features of positively selected genes, generating spurious signals in selective sweep scans. Given the intrinsic difficulties of interpreting selection mapping data, additional tools, such as genome-wide association studies based on high throughput genotyping or whole-genome sequencing data obtained from large reference populations, will be indispensable to uncover the biological meaning of selective sweep signatures.Relationship between variation at markers mapping to putative selective sweeps and productive specialization. The main goal of our study was to map selective sweeps related with the geneticEthics statement. Blood samples were collected from sheep by trained veterinarians in the context of sanitation campaigns and parentage controls not directly related with our research project. In all instances, veterinarians followed standard procedures and relevant Spanish national guidelines to ensure an appropriate animal care. Nucleic acid purification and genotyping with the Ovine 50 K SNP BeadChip. Blood was extractedwith Vacutainer tubes from 141 sheep corresponding to the Segure (N = 12), Xisqueta (N = 25), RipollesaMaterials and MethodsScientific RepoRts | 6:27296 | DOI: 10.1038/srepwww.nature.com/scientificreports/(N = 23), Gallega (N = 25), Canaria de Pelo (N = 27), and Roja Mallorquina (N = 29) breeds. Leukocytes were purified from whole blood by carrying out several washing steps with TE buffer (Tris 10 mM, EDTA 1 mM, pH 8.0). In this way, a volume of TE was added to 500 l blood and this mixture was vortexed and centrifuged at 13,000 rpm for 30 seconds. This procedure was repeated until a clean white pellet was obtained. Next, the cell pellet was resuspended in 200 l cell lysis buffer (50 mM KCl, 10 mM Tris, 0.5 Tween 20) with 10 l proteinase K (10 mg/ml) and incubated for 4 hours at 56 . One volume of phenol:chloroform:isoamyl alcohol (25:24:1) was added to the lysate, and the resulting mixture was vortexed and centrifuged at 13,000 rpm for 15 min. Subsequently, the aqueous upper layer was transferred to a fresh tube and 2 M NaCl (0.1 volumes) and absolute ethanol (2 volumes at -20 ) were added. After a centrifugation step at 13,000 rpm for 30 min., the supernatant was discarded and salt contamination was removed by performing a washing step with 500 l 70 ethanol. Finally, the DNA pellet was air-dried at room temperature, and resuspended in 50 l milli-Q water. Genomic DNA samples obtained in this way were typed for 54,241 SNPs with the Ovine 50 K SNP BeadChip following standard protocols (http://www.illumina.com). Moderate sample size and the low density of this genotyping platform may have limited to some extent the power of our experiment. However, this was the only high throughput SNP typing tool available at the time we initiated genotyping tasks. The GenomeStudio software (Illumina) was used to generate standard ped and map files as well as to perform sample and marker-based quality control measures (we considered a GenCall score cutoff of 0.15 and an average sample call rate of 99 ). Genotyping data generated in the current work were submitted to the International Sheep Genomics Consortium database (ISGC, http://www.sheephapmap.org) and they should be available upon request. Besides the 50 K data generated in our project for six ovine breeds from Spain, in the population structure and selection analyses we also used existing 50 K data from 229 sheep belon.

Appeared perfectly clean. Scholars such as Livingston (2008) have emphasized the importance

Appeared perfectly clean. Scholars such as Livingston (2008) have emphasized the HIV-1 integrase inhibitor 2MedChemExpress HIV-1 integrase inhibitor 2 importance of bodily aesthetic practices to sociability and personhood. Bathing is particularly powerful, as Durham notes, because ‘the labor involved in preparing a bath enters into negotiations of loving care’ (2005: 191). ‘M’e Mapole took excellent care of Letlo. She was extremely diligent about keeping him clean, not only for his benefit, but as an outward sign to others that she was an adequate caregiver.J R Anthropol Inst. Author manuscript; available in PMC 2015 April 08.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptBlockPageMost of the caregivers I spoke with, young and old alike, agreed that it is the father’s side of the family who is responsible for orphans according to ‘Sesotho culture’ (meetlo ea Sesotho). Basotho still hold strong ideals about patrilineal Procyanidin B1 site inheritance, naming, gender roles, marriage practices, and the lineages of children. However, in response to the increase in AIDS orphans, configurations of care that are not in line with patrilineal rules about residence are occurring across Southern Africa (Adato et al. 2005; Cooper 2012; Howard et al. 2006; Ksoll 2007; Nyambedha, Wandibba Aagaard-Hansen 2003; Oleke et al. 2005).While child fostering (or any other cultural practice, for that matter) has never aligned with idealized rules, and while historical data detailing the care of orphans in Lesotho are sparse, there is reason to believe that this pattern of care is occurring with increasing frequency. In Lesotho, most people are surprisingly flexible when it comes to the locality of care, and agree that it is important to ascertain the best environment for a child on a case-by-case basis. As one young maternal caregiver told me, ‘[The family is] just looking at the situation, how the children are going to grow up’. This sentiment was expressed by many, including one maternal great-grandmother who said, ‘Ache! I don’t like the rules. It’s better if you can look at the situation for how we should help the children’. Ideally, caregiver quality is assessed not merely by the ability to meet the physical needs of the child, but also according to the character of the caregiver, the proximity of the kin connection, and the ability of a caregiver to provide love to a child (Goldberg Short 2012).’M’e Nthabiseng, the managing director of MCS, agreed that care is being privileged over customary norms. She said: Culturally, a child from a married couple belongs to the father’s side. But what I see happening now, children not living with their parents go to either side of the family depending on relationships of both families, who is willing to have an additional child in his or her family and which side has a living grandmother. I am saying this because with the existing poverty, people on both side[s] are hesitant in volunteering to care for children … [T]hese days it does not really matter which side the children are cared for but what is important is the side that is willing to provide better care. A child’s embeddedness in the paternal family depends on ill-defined and changing markers of patrilineal social organization, such as bridewealth, that are no longer reflected in patterns of child circulation and care. Over three-quarters of MCS clients between 2007 and 2012 not living with a parent were living with a maternal relative, the majority of them grandmothers. This strong trend towards matrilocal care among o.Appeared perfectly clean. Scholars such as Livingston (2008) have emphasized the importance of bodily aesthetic practices to sociability and personhood. Bathing is particularly powerful, as Durham notes, because ‘the labor involved in preparing a bath enters into negotiations of loving care’ (2005: 191). ‘M’e Mapole took excellent care of Letlo. She was extremely diligent about keeping him clean, not only for his benefit, but as an outward sign to others that she was an adequate caregiver.J R Anthropol Inst. Author manuscript; available in PMC 2015 April 08.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptBlockPageMost of the caregivers I spoke with, young and old alike, agreed that it is the father’s side of the family who is responsible for orphans according to ‘Sesotho culture’ (meetlo ea Sesotho). Basotho still hold strong ideals about patrilineal inheritance, naming, gender roles, marriage practices, and the lineages of children. However, in response to the increase in AIDS orphans, configurations of care that are not in line with patrilineal rules about residence are occurring across Southern Africa (Adato et al. 2005; Cooper 2012; Howard et al. 2006; Ksoll 2007; Nyambedha, Wandibba Aagaard-Hansen 2003; Oleke et al. 2005).While child fostering (or any other cultural practice, for that matter) has never aligned with idealized rules, and while historical data detailing the care of orphans in Lesotho are sparse, there is reason to believe that this pattern of care is occurring with increasing frequency. In Lesotho, most people are surprisingly flexible when it comes to the locality of care, and agree that it is important to ascertain the best environment for a child on a case-by-case basis. As one young maternal caregiver told me, ‘[The family is] just looking at the situation, how the children are going to grow up’. This sentiment was expressed by many, including one maternal great-grandmother who said, ‘Ache! I don’t like the rules. It’s better if you can look at the situation for how we should help the children’. Ideally, caregiver quality is assessed not merely by the ability to meet the physical needs of the child, but also according to the character of the caregiver, the proximity of the kin connection, and the ability of a caregiver to provide love to a child (Goldberg Short 2012).’M’e Nthabiseng, the managing director of MCS, agreed that care is being privileged over customary norms. She said: Culturally, a child from a married couple belongs to the father’s side. But what I see happening now, children not living with their parents go to either side of the family depending on relationships of both families, who is willing to have an additional child in his or her family and which side has a living grandmother. I am saying this because with the existing poverty, people on both side[s] are hesitant in volunteering to care for children … [T]hese days it does not really matter which side the children are cared for but what is important is the side that is willing to provide better care. A child’s embeddedness in the paternal family depends on ill-defined and changing markers of patrilineal social organization, such as bridewealth, that are no longer reflected in patterns of child circulation and care. Over three-quarters of MCS clients between 2007 and 2012 not living with a parent were living with a maternal relative, the majority of them grandmothers. This strong trend towards matrilocal care among o.

Although there were no detectable changes in levels of measured cytokines

Although there were no detectable changes in levels of measured cytokines111. Epidural PNPP site anesthesia reduces the plasma levels of norepinephrine during surgery when compared to general anesthesia112. This holds true when combined general and epidural anesthesia is compared to general anesthesia alone113. Norepinephrine and epinephrine induce vasoconstriction in the microcirculation114 and also have effects on subsequent biological processes that influence wound repair, such as angiogenesis and inflammation. For example, norepinephrine significantly increased secretion of the angiogenic factor VEGF by ovarian cancer and melanoma cell lines115, 116. Furthermore, epinephrine suppresses phagocytosis of soluble immune complexes (aggregated gamma-globulin) by macrophages in a dosedependent manner117 (Figure 4). IIID2. Volatile anesthetics agents–Volatile anesthetic agents have several contradictory effects on microcirculatory flow. They decrease flow in the microcirculation by reducing arterial perfusion pressure and depressing myocardial contractility. At the same time these agents can increase flow in the microcirculation by inducing a vasodilatory response118. As a result, clinically useful concentrations of volatile agents will often produce systemic hypotension and decrease regional tissue perfusion in a tissue and agent specific manner119. Muscle perfusion under anesthesia with volatile agents is better maintained in young subjects than in aged subjects120. Not all effects of inhalation anesthesia are detrimental to tissue repair (Figure 5). Volatile anesthetics protect against ischemia-reperfusion injury of several organs (heart121, liver122, kidney123 and potentially others) by reducing SKF-96365 (hydrochloride) chemical information necrosis and inflammation124. Several lines of evidence suggest that inhalation anesthetics exert their effects by affecting the microcirculation and influencing subsequent angiogenesis. For example, exposure to volatile anesthetics stimulates growth and proliferation of endothelial progenitor cells125. Volatile anesthetics, at clinically relevant doses, block transcription factor Hypoxia-inducible factor-1 activity and expression of its downstream target genes. Hypoxia-inducible factor-1 is a transcriptional regulator of VEGF expression126 and mediates angiogenic responses to reduced oxygen availability127. When renal proximal tubule cells were exposed to volatile anesthetics for sixteen hours there was increased production and release of TGF-1, a potent stimulator of extracellular matrix synthesis, into the cell culture media. The role of TGF-1 in the protective effect of volatile agents on ischemic injury to the kidney was specifically demonstrated in vivo – mice heterozygous for TGF-1 (TGF-1) were not protected from ischemia reperfusion injury by sevoflurane and a neutralizing TGF-1 antibody blockedAnesthesiology. Author manuscript; available in PMC 2015 March 01.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptBentov and ReedPagerenal protection with sevoflurane in TGF-1 mice128. Despite the data above, it is worth noting that volatile anesthetic agents differ in their effects on the microcirculation with respect to specific agents (desflurane versus isoflurane versus sevoflurane), target organs (heart versus kidney versus splanchnic), and clinical states (healthy versus sepsis versus hemorrhagic states)129. Consequently, we cannot make meaningful recommendations regarding volatile anesthetics and wound healing outcomes. III.Although there were no detectable changes in levels of measured cytokines111. Epidural anesthesia reduces the plasma levels of norepinephrine during surgery when compared to general anesthesia112. This holds true when combined general and epidural anesthesia is compared to general anesthesia alone113. Norepinephrine and epinephrine induce vasoconstriction in the microcirculation114 and also have effects on subsequent biological processes that influence wound repair, such as angiogenesis and inflammation. For example, norepinephrine significantly increased secretion of the angiogenic factor VEGF by ovarian cancer and melanoma cell lines115, 116. Furthermore, epinephrine suppresses phagocytosis of soluble immune complexes (aggregated gamma-globulin) by macrophages in a dosedependent manner117 (Figure 4). IIID2. Volatile anesthetics agents–Volatile anesthetic agents have several contradictory effects on microcirculatory flow. They decrease flow in the microcirculation by reducing arterial perfusion pressure and depressing myocardial contractility. At the same time these agents can increase flow in the microcirculation by inducing a vasodilatory response118. As a result, clinically useful concentrations of volatile agents will often produce systemic hypotension and decrease regional tissue perfusion in a tissue and agent specific manner119. Muscle perfusion under anesthesia with volatile agents is better maintained in young subjects than in aged subjects120. Not all effects of inhalation anesthesia are detrimental to tissue repair (Figure 5). Volatile anesthetics protect against ischemia-reperfusion injury of several organs (heart121, liver122, kidney123 and potentially others) by reducing necrosis and inflammation124. Several lines of evidence suggest that inhalation anesthetics exert their effects by affecting the microcirculation and influencing subsequent angiogenesis. For example, exposure to volatile anesthetics stimulates growth and proliferation of endothelial progenitor cells125. Volatile anesthetics, at clinically relevant doses, block transcription factor Hypoxia-inducible factor-1 activity and expression of its downstream target genes. Hypoxia-inducible factor-1 is a transcriptional regulator of VEGF expression126 and mediates angiogenic responses to reduced oxygen availability127. When renal proximal tubule cells were exposed to volatile anesthetics for sixteen hours there was increased production and release of TGF-1, a potent stimulator of extracellular matrix synthesis, into the cell culture media. The role of TGF-1 in the protective effect of volatile agents on ischemic injury to the kidney was specifically demonstrated in vivo – mice heterozygous for TGF-1 (TGF-1) were not protected from ischemia reperfusion injury by sevoflurane and a neutralizing TGF-1 antibody blockedAnesthesiology. Author manuscript; available in PMC 2015 March 01.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptBentov and ReedPagerenal protection with sevoflurane in TGF-1 mice128. Despite the data above, it is worth noting that volatile anesthetic agents differ in their effects on the microcirculation with respect to specific agents (desflurane versus isoflurane versus sevoflurane), target organs (heart versus kidney versus splanchnic), and clinical states (healthy versus sepsis versus hemorrhagic states)129. Consequently, we cannot make meaningful recommendations regarding volatile anesthetics and wound healing outcomes. III.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted Tariquidar custom synthesis reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the Mirogabalin site intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section EPZ004777 molecular weight concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we Necrosulfonamide supplement compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Hological evidence for an autocrine/paracrine action of nitric oxide. Kidney

Hological evidence for an autocrine/paracrine action of nitric oxide. Kidney international. 2003; 64:170?0. [PubMed: 12787407]Author Manuscript Author Manuscript Author Manuscript Author ManuscriptActa Histochem. Author manuscript; available in PMC 2017 March 01.Slyvka et al.PageJeong KH, Lee TW, Ihm CG, Lee SH, Moon JY, Lim SJ. Effects of sildenafil on oxidative and inflammatory injuries of the kidney in streptozotocin-induced diabetic rats. Am J Nephrol. 2009; 29:274?2. [PubMed: 18812693] Kanetsuna Y, Takahashi K, Nagata M, Gannon MA, Breyer MD, Harris RC, et al. Deficiency of endothelial nitric-oxide synthase confers susceptibility to diabetic nephropathy in nephropathyresistant inbred mice. Am J Pathol. 2007; 170:1473?4. [PubMed: 17456755] Kasiske BL, Cleary MP, O’Donnell MP, Keane WF. Effects of genetic obesity on renal structure and function in the Zucker rat. J Lab Clin Med. 1985; 106:598?04. [PubMed: 4056570] Keil A, Blom IE, Goldschmeding R, Rupprecht HD. Nitric oxide down-regulates connective tissue growth factor in rat mesangial cells. Kidney Int. 2002; 62:401?1. [PubMed: 12110001] Komers R, Anderson S. Paradoxes of nitric oxide in the diabetic kidney. Am J Physiol Renal Physiol. 2003; 284:F1121?7. [PubMed: 12736164] Komers R, Lindsley JN, Oyama TT, Allison KM, Anderson S. Role of neuronal nitric oxide synthase (NOS1) in the pathogenesis of renal hemodynamic changes in diabetes. American journal of physiology Renal physiology. 2000; 279:F573?3. [PubMed: 10966937] Kuloglu T, Aydin S. Immunohistochemical expressions of adropin and inducible nitric oxide synthase in renal tissues of rats with streptozotocin-induced experimental diabetes. Biotechnic histochemistry: official publication of the Biological Stain Commission. 2014; 89:104?0. [PubMed: 23957703] Kwan G, Neugarten J, Sherman M, Ding Q, Fotadar U, Lei J, et al. Effects of sex hormones on mesangial cell proliferation and collagen synthesis. Kidney international. 1996; 50:1173?. [PubMed: 8887275] Lee HB, Seo JY, Yu MR, Uh ST, Ha H. Radical approach to diabetic nephropathy. Kidney Int Suppl. 2007:S67?0. [PubMed: 17653214] Lee HS. Oxidized LDL, glomerular mesangial cells and collagen. Diabetes Res Clin Pract. 1999; 45:117?2. [PubMed: 10588363] Li Z, Rodriguez-Iturbe B, Ni Z, Shahkarami A, Sepassi L, Vaziri ND. Effect of hereditary obesity on renal expressions of NO synthase, caveolin-1, AKt, guanylate cyclase, and calmodulin. Kidney Int. 2005; 68:2766?2. [PubMed: 16316351] Liang JH, Li YN, Qi JS, Jia XX. Peroxynitrite-induced protein nitration is responsible for renal GSK343MedChemExpress GSK343 mitochondrial damage in diabetic rat. Journal of endocrinological investigation. 2010; 33:140?. [PubMed: 19783894] Maeda M, Yabuki A, Suzuki S, Matsumoto M, Taniguchi K, Nishinakagawa H. Renal lesions in spontaneous insulin-dependent diabetes mellitus in the nonobese diabetic mouse: acute phase of diabetes. Veterinary PF-04418948 mechanism of action pathology. 2003; 40:187?5. [PubMed: 12637759] Majid DS, Navar LG. Nitric oxide in the control of renal hemodynamics and excretory function. Am J Hypertens. 2001; 14:74S?2S. [PubMed: 11411769] Montonen J, Knekt P, Jarvinen R, Reunanen A. Dietary antioxidant intake and risk of type 2 diabetes. Diabetes Care. 2004; 27:362?. [PubMed: 14747214] Moon JY, Tanimoto M, Gohda T, Hagiwara S, Yamazaki T, Ohara I, et al. Attenuating effect of angiotensin-(1-7) on angiotensin II-mediated NAD(P)H oxidase activation in type 2 diabetic nephropathy of KK-A(y)/Ta mice. Am J Physiol Renal Physiol. 2011; 300:F1271?2.Hological evidence for an autocrine/paracrine action of nitric oxide. Kidney international. 2003; 64:170?0. [PubMed: 12787407]Author Manuscript Author Manuscript Author Manuscript Author ManuscriptActa Histochem. Author manuscript; available in PMC 2017 March 01.Slyvka et al.PageJeong KH, Lee TW, Ihm CG, Lee SH, Moon JY, Lim SJ. Effects of sildenafil on oxidative and inflammatory injuries of the kidney in streptozotocin-induced diabetic rats. Am J Nephrol. 2009; 29:274?2. [PubMed: 18812693] Kanetsuna Y, Takahashi K, Nagata M, Gannon MA, Breyer MD, Harris RC, et al. Deficiency of endothelial nitric-oxide synthase confers susceptibility to diabetic nephropathy in nephropathyresistant inbred mice. Am J Pathol. 2007; 170:1473?4. [PubMed: 17456755] Kasiske BL, Cleary MP, O’Donnell MP, Keane WF. Effects of genetic obesity on renal structure and function in the Zucker rat. J Lab Clin Med. 1985; 106:598?04. [PubMed: 4056570] Keil A, Blom IE, Goldschmeding R, Rupprecht HD. Nitric oxide down-regulates connective tissue growth factor in rat mesangial cells. Kidney Int. 2002; 62:401?1. [PubMed: 12110001] Komers R, Anderson S. Paradoxes of nitric oxide in the diabetic kidney. Am J Physiol Renal Physiol. 2003; 284:F1121?7. [PubMed: 12736164] Komers R, Lindsley JN, Oyama TT, Allison KM, Anderson S. Role of neuronal nitric oxide synthase (NOS1) in the pathogenesis of renal hemodynamic changes in diabetes. American journal of physiology Renal physiology. 2000; 279:F573?3. [PubMed: 10966937] Kuloglu T, Aydin S. Immunohistochemical expressions of adropin and inducible nitric oxide synthase in renal tissues of rats with streptozotocin-induced experimental diabetes. Biotechnic histochemistry: official publication of the Biological Stain Commission. 2014; 89:104?0. [PubMed: 23957703] Kwan G, Neugarten J, Sherman M, Ding Q, Fotadar U, Lei J, et al. Effects of sex hormones on mesangial cell proliferation and collagen synthesis. Kidney international. 1996; 50:1173?. [PubMed: 8887275] Lee HB, Seo JY, Yu MR, Uh ST, Ha H. Radical approach to diabetic nephropathy. Kidney Int Suppl. 2007:S67?0. [PubMed: 17653214] Lee HS. Oxidized LDL, glomerular mesangial cells and collagen. Diabetes Res Clin Pract. 1999; 45:117?2. [PubMed: 10588363] Li Z, Rodriguez-Iturbe B, Ni Z, Shahkarami A, Sepassi L, Vaziri ND. Effect of hereditary obesity on renal expressions of NO synthase, caveolin-1, AKt, guanylate cyclase, and calmodulin. Kidney Int. 2005; 68:2766?2. [PubMed: 16316351] Liang JH, Li YN, Qi JS, Jia XX. Peroxynitrite-induced protein nitration is responsible for renal mitochondrial damage in diabetic rat. Journal of endocrinological investigation. 2010; 33:140?. [PubMed: 19783894] Maeda M, Yabuki A, Suzuki S, Matsumoto M, Taniguchi K, Nishinakagawa H. Renal lesions in spontaneous insulin-dependent diabetes mellitus in the nonobese diabetic mouse: acute phase of diabetes. Veterinary pathology. 2003; 40:187?5. [PubMed: 12637759] Majid DS, Navar LG. Nitric oxide in the control of renal hemodynamics and excretory function. Am J Hypertens. 2001; 14:74S?2S. [PubMed: 11411769] Montonen J, Knekt P, Jarvinen R, Reunanen A. Dietary antioxidant intake and risk of type 2 diabetes. Diabetes Care. 2004; 27:362?. [PubMed: 14747214] Moon JY, Tanimoto M, Gohda T, Hagiwara S, Yamazaki T, Ohara I, et al. Attenuating effect of angiotensin-(1-7) on angiotensin II-mediated NAD(P)H oxidase activation in type 2 diabetic nephropathy of KK-A(y)/Ta mice. Am J Physiol Renal Physiol. 2011; 300:F1271?2.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two get CPI-455 water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be I-CBP112 site judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Ull view of MARE is helpful for medical education to improve

Ull view of MARE is helpful for medical education to improve professional development from knowledge to practice. The three learning theories provide foundational support from the different views of the relationship among learning, practice, and environment. The outcome layer, which analyzes different ability levels from knowledge to practice, can possibly avoid “teaching pitched at the wrong level” [30], and it can also fill the gap between teaching and CBR-5884MedChemExpress CBR-5884 clinical practice needs. Moreover, AR is a potential tool to help health care educators fill the gap between teaching and clinical practice, especially through guidance by theories to achieve the aim. The MARE framework meets clinical teaching goals listed in the Association for Medical Education in Europe (AMEE) Guides that apply relevant educational theories to guide clinical teaching in the hospital setting [29].Comparison With Prior WorkThe MARE framework is a general instructional design framework that addresses functional conceptualism by explaining and predicting theory with a multidisciplinary perspective [6,59]. Similarly, the general instructional design framework has been used to design e-learning and simulation training frameworks. Situation learning theory was used to guide the design of the learning environment and learning activities for an instructional design model, and transformative learning theory was used to build an e-learning framework [54]. Identifying the learning aim is important for a framework that uses the design process in electrical engineering as a model [60]. Edelson developed a framework with principles and learning activities from the inquiry-based cycle [61]. Distinct from these frameworks, the MARE framework tries to meet all components of functional conceptualism: goal, values, functions, and situations. Learning theories are the foundation of the MARE supporting values. Their selection corresponds to the characteristics of AR and GP learning outcomes. Clarifying the learning goal is the important first step in MARE instructional design. Learning activities are manipulable variables within learning environments. Activities are suggested from learning theories to achieve learning outcomes. Learning activities are described along with the situations for guiding when and how to apply them in the MARE framework.Implications and Future WorkThe proposed MARE design framework addresses the lack of theory for guiding the design, development, and application of AR to improve GPs’ rational use of antibiotics. Understanding the theory behind this framework could benefit instructional designers, AR developers, and GP professionals when they apply the recommendations and could ultimately lead to further development of this framework and its practical use. The first implication of MARE for AR designers is how to apply learning theories and learning outcomes to guide AR instructional design. Situated learning theory, experiential learning theory, and transformative learning theory share some views, but each has unique emphases. The learning activities from which the learning theories are based are effective substitutes for traditional medical instruction in AR environments. The fundamental change in pedagogical philosophy is better than the tinkering with “interactivity” levels by instructional designers to support deeper, richer levels of learning [54]. The learning outcome framework (Figure 2), which combines Miller’s pyramid of clinical assessment and PP58 site Bloom’s t.Ull view of MARE is helpful for medical education to improve professional development from knowledge to practice. The three learning theories provide foundational support from the different views of the relationship among learning, practice, and environment. The outcome layer, which analyzes different ability levels from knowledge to practice, can possibly avoid “teaching pitched at the wrong level” [30], and it can also fill the gap between teaching and clinical practice needs. Moreover, AR is a potential tool to help health care educators fill the gap between teaching and clinical practice, especially through guidance by theories to achieve the aim. The MARE framework meets clinical teaching goals listed in the Association for Medical Education in Europe (AMEE) Guides that apply relevant educational theories to guide clinical teaching in the hospital setting [29].Comparison With Prior WorkThe MARE framework is a general instructional design framework that addresses functional conceptualism by explaining and predicting theory with a multidisciplinary perspective [6,59]. Similarly, the general instructional design framework has been used to design e-learning and simulation training frameworks. Situation learning theory was used to guide the design of the learning environment and learning activities for an instructional design model, and transformative learning theory was used to build an e-learning framework [54]. Identifying the learning aim is important for a framework that uses the design process in electrical engineering as a model [60]. Edelson developed a framework with principles and learning activities from the inquiry-based cycle [61]. Distinct from these frameworks, the MARE framework tries to meet all components of functional conceptualism: goal, values, functions, and situations. Learning theories are the foundation of the MARE supporting values. Their selection corresponds to the characteristics of AR and GP learning outcomes. Clarifying the learning goal is the important first step in MARE instructional design. Learning activities are manipulable variables within learning environments. Activities are suggested from learning theories to achieve learning outcomes. Learning activities are described along with the situations for guiding when and how to apply them in the MARE framework.Implications and Future WorkThe proposed MARE design framework addresses the lack of theory for guiding the design, development, and application of AR to improve GPs’ rational use of antibiotics. Understanding the theory behind this framework could benefit instructional designers, AR developers, and GP professionals when they apply the recommendations and could ultimately lead to further development of this framework and its practical use. The first implication of MARE for AR designers is how to apply learning theories and learning outcomes to guide AR instructional design. Situated learning theory, experiential learning theory, and transformative learning theory share some views, but each has unique emphases. The learning activities from which the learning theories are based are effective substitutes for traditional medical instruction in AR environments. The fundamental change in pedagogical philosophy is better than the tinkering with “interactivity” levels by instructional designers to support deeper, richer levels of learning [54]. The learning outcome framework (Figure 2), which combines Miller’s pyramid of clinical assessment and Bloom’s t.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access Bay 41-4109 chemical information request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to Entinostat chemical information initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a DM-3189MedChemExpress DM-3189 certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the MS023 site Individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically AKB-6548 supplier significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher AKB-6548MedChemExpress Vadadustat chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Ith grade. No systematic associations were observed between agentic goals and

Ith grade. No systematic associations were observed between agentic goals and 3-MethyladenineMedChemExpress 3-MA alcohol use (6th grade: r=.02, 7th grade: r=.17, 8th grade: r=.04, 9th grade: r=.11) and the strength of the association between communal goals and alcohol use decreased with grade (6th grade: r=.22, 7th grade: r=.13, 8th grade: r=.04, 9th grade: r=.-.03).Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageMultilevel ModelsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptThe gender interaction terms did not significantly improve model fit (2 [8, N=386]=5.16, p>.05), and were not considered further. However, the first-order effect of gender was PD0325901 web included as a statistical control variable in models testing grade interaction terms. A nested chi-square test comparing a model with and without the hypothesized interaction terms with grade suggested that model fit improved with the inclusion of twoway (2 [8, N=386]=18.25, p<.05) and three-way (2 [4, N=386]=11.21, p<.05) interactions. As shown in Table 1, significant three-way interaction terms were found for grade ?descriptive norm ?communal goals (B =-0.33, p=.03), grade ?injunctive norms ?communal goals (B =0.30, p=.03), and grade ?descriptive norms ?agentic goals (B=0.24, p=.04). The grade ?injunctive norms ?agentic goals three-way interaction term was not statistically significant (B =-0.15, p=.30). To facilitate interpretation of the three-way interaction terms, simple slopes of norms by levels of social goals were plotted for an early (6th variables predicting 7th grade alcohol use) and late (9th grade variables predicting 10 grade alcohol use) cross-lag (see Figure 1). Descriptive Norms Descriptive Norms and Agentic Goals As seen in Panel A of Figure 1, for adolescents in the 6th grade, descriptive norms were not found to significantly predict 7th grade alcohol use for adolescents with high or low levels of agentic goals (OR=0.86 and 1.71, respectively, both ps>.05). High levels of descriptive norms in the 9th grade were associated with increased probability of alcohol use in the 10th grade for adolescents with high (OR=2.43 p<.05), but not low (OR=1.09, p>.05) levels of agentic goals. This pattern provides partial support for the hypothesized interaction between descriptive norms, agentic goals and grade. That is, there was a shift in the moderating role of agentic social goals with grade, such that descriptive norms became a predictor of alcohol use for youth characterized by strong agentic goals, but only in later grades. Descriptive Norms and Communal Goals High levels of descriptive norms in the 6th grade were associated with increased probability of alcohol use in the 7th grade for adolescents characterized by high (OR=2.07, p<.05) but not low (OR=0.72, p>.05) levels of communal goals. As seen in Panel 2 of Figure 1, in later grades, this pattern reversed itself, such that 9th grade descriptive norms were not associated with 10th grade drinking for adolescents high in communal goals (OR=0.72, p>.05), but they were associated with 10th grade drinking for adolescents low in communal goals (OR=2.58, p>.05). Although descriptive norms were not hypothesized to interact with communal goals, these findings suggest a developmental shift such that in early adolescence, descriptive norms influence alcohol use for those characterized by strong communal goals whereas in later adolescence descriptive norms influence alcohol use for adolescents character.Ith grade. No systematic associations were observed between agentic goals and alcohol use (6th grade: r=.02, 7th grade: r=.17, 8th grade: r=.04, 9th grade: r=.11) and the strength of the association between communal goals and alcohol use decreased with grade (6th grade: r=.22, 7th grade: r=.13, 8th grade: r=.04, 9th grade: r=.-.03).Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageMultilevel ModelsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptThe gender interaction terms did not significantly improve model fit (2 [8, N=386]=5.16, p>.05), and were not considered further. However, the first-order effect of gender was included as a statistical control variable in models testing grade interaction terms. A nested chi-square test comparing a model with and without the hypothesized interaction terms with grade suggested that model fit improved with the inclusion of twoway (2 [8, N=386]=18.25, p<.05) and three-way (2 [4, N=386]=11.21, p<.05) interactions. As shown in Table 1, significant three-way interaction terms were found for grade ?descriptive norm ?communal goals (B =-0.33, p=.03), grade ?injunctive norms ?communal goals (B =0.30, p=.03), and grade ?descriptive norms ?agentic goals (B=0.24, p=.04). The grade ?injunctive norms ?agentic goals three-way interaction term was not statistically significant (B =-0.15, p=.30). To facilitate interpretation of the three-way interaction terms, simple slopes of norms by levels of social goals were plotted for an early (6th variables predicting 7th grade alcohol use) and late (9th grade variables predicting 10 grade alcohol use) cross-lag (see Figure 1). Descriptive Norms Descriptive Norms and Agentic Goals As seen in Panel A of Figure 1, for adolescents in the 6th grade, descriptive norms were not found to significantly predict 7th grade alcohol use for adolescents with high or low levels of agentic goals (OR=0.86 and 1.71, respectively, both ps>.05). High levels of descriptive norms in the 9th grade were associated with increased probability of alcohol use in the 10th grade for adolescents with high (OR=2.43 p<.05), but not low (OR=1.09, p>.05) levels of agentic goals. This pattern provides partial support for the hypothesized interaction between descriptive norms, agentic goals and grade. That is, there was a shift in the moderating role of agentic social goals with grade, such that descriptive norms became a predictor of alcohol use for youth characterized by strong agentic goals, but only in later grades. Descriptive Norms and Communal Goals High levels of descriptive norms in the 6th grade were associated with increased probability of alcohol use in the 7th grade for adolescents characterized by high (OR=2.07, p<.05) but not low (OR=0.72, p>.05) levels of communal goals. As seen in Panel 2 of Figure 1, in later grades, this pattern reversed itself, such that 9th grade descriptive norms were not associated with 10th grade drinking for adolescents high in communal goals (OR=0.72, p>.05), but they were associated with 10th grade drinking for adolescents low in communal goals (OR=2.58, p>.05). Although descriptive norms were not hypothesized to interact with communal goals, these findings suggest a developmental shift such that in early adolescence, descriptive norms influence alcohol use for those characterized by strong communal goals whereas in later adolescence descriptive norms influence alcohol use for adolescents character.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn Valsartan/sacubitril msds benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Lixisenatide molecular weight manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Been used to detect attachment of lipoic acid to apo forms

Been used to detect attachment of lipoic acid to apo forms of PDH and 2OGDH in vitro. The first assay measured the conversion of radioactive lipoate (or octanoate) to a protein-bound form defined as being insoluble in organic solvents (199). This is a sensitive and quantitative assay, but applicable only to LplA since both the LipB substrate and product are protein bound. The second assay relies on the use of inactive unmodified apo-PDH or 2-OGDH complex purified from a lipB lplA strain completely deficient in modification of the E2 proteins. Lipoylation of the purified apo-PDH or 2-OGDH complex was detected by assay of the products of ligation reactions for either PDH or 2-OGDH activity (222). The third assay is a gel mobility shift assay (218). It Deslorelin manufacturer follows the acylationdependent shift in the electrophoretic mobility of a purified 87 residue apo-lipoyl domain from the E. coli PDH complex (223). This assay is much less sensitive than the other two but has the advantage that it can be used with any acyl donor because the mobility shift is due to loss of the positive charge of the lysine residue. With this assay it was found that purified LipB could convert the apo form of lipoyl domain to the holo domain with either octanoyl-ACP or lipoyl-ACP as the substrate. When LipB was tested for the ability to use ATP plus lipoic acid or octanoic acid, no modification was detected. Another lipB phenotype is that multiple copies of the gene confer resistance to selenolipoic acid. An analogue-resistant mutant that did not map at the lplA locus (209) was shown to be a chromosomal amplification of the lipA lipB region of the chromosome (224). TheEcoSal Plus. Author manuscript; available in PMC 2015 January 06.CronanPageincreased lipB dosage resulted in greater LipB activity that resulted in increased levels of lipoylation by endogenously synthesized lipoic acid that competed with the utilization of exogenous selenolipoic acid via the LplA-dependent pathway. A very modest (two- to threefold) increase in lipB dosage was sufficient to give resistance which was explained by the known highly nonlinear relationship between the degree of protein lipoylation and the activity of the 2-oxoacid dehydrogenase BAY1217389 chemical information complexes plus the fact that E. coli does not require full activity of the 2-oxoacid dehydrogenases for growth on minimal medium containing glucose (224). Thus, synthesis of sufficient lipoic acid to modify a few percent of the 2-oxo acid dehydrogenase complexes allowed growth in presence of selenolipoic acid. As mentioned above the LipB reaction was recently shown to proceed via an acyl enzyme intermediate (225). The octanoyl group is transferred from the ACP thiol to the thiol of Cys-169. This protein-bound thioester is then attacked by the -amino group of the lipoyl domain lysine to give the modified domain. Octanoyl-ACP + LipB [Octanoyl-LipB] + ACP-SH [Octanoyl-LipB] + Apo Lipoyl Domain * Octanoyl-E2 Domain The fact that LipB could transfer either octanoate or lipoate from ACP to a lipoyl domain raised the question of the true intracellular substrate of the enzyme. This has been answered by overexpression of LipB and isolating the enzyme under conditions that retained any acylenzyme interemediate present. Mass spectrometry showed that only octanoate was attached to the enzyme thereby demonstrating the specificity of the enzyme (226). The reactivity of the cysteine residue seems responsible for the both LipB crystal structure scurrently available, those o.Been used to detect attachment of lipoic acid to apo forms of PDH and 2OGDH in vitro. The first assay measured the conversion of radioactive lipoate (or octanoate) to a protein-bound form defined as being insoluble in organic solvents (199). This is a sensitive and quantitative assay, but applicable only to LplA since both the LipB substrate and product are protein bound. The second assay relies on the use of inactive unmodified apo-PDH or 2-OGDH complex purified from a lipB lplA strain completely deficient in modification of the E2 proteins. Lipoylation of the purified apo-PDH or 2-OGDH complex was detected by assay of the products of ligation reactions for either PDH or 2-OGDH activity (222). The third assay is a gel mobility shift assay (218). It follows the acylationdependent shift in the electrophoretic mobility of a purified 87 residue apo-lipoyl domain from the E. coli PDH complex (223). This assay is much less sensitive than the other two but has the advantage that it can be used with any acyl donor because the mobility shift is due to loss of the positive charge of the lysine residue. With this assay it was found that purified LipB could convert the apo form of lipoyl domain to the holo domain with either octanoyl-ACP or lipoyl-ACP as the substrate. When LipB was tested for the ability to use ATP plus lipoic acid or octanoic acid, no modification was detected. Another lipB phenotype is that multiple copies of the gene confer resistance to selenolipoic acid. An analogue-resistant mutant that did not map at the lplA locus (209) was shown to be a chromosomal amplification of the lipA lipB region of the chromosome (224). TheEcoSal Plus. Author manuscript; available in PMC 2015 January 06.CronanPageincreased lipB dosage resulted in greater LipB activity that resulted in increased levels of lipoylation by endogenously synthesized lipoic acid that competed with the utilization of exogenous selenolipoic acid via the LplA-dependent pathway. A very modest (two- to threefold) increase in lipB dosage was sufficient to give resistance which was explained by the known highly nonlinear relationship between the degree of protein lipoylation and the activity of the 2-oxoacid dehydrogenase complexes plus the fact that E. coli does not require full activity of the 2-oxoacid dehydrogenases for growth on minimal medium containing glucose (224). Thus, synthesis of sufficient lipoic acid to modify a few percent of the 2-oxo acid dehydrogenase complexes allowed growth in presence of selenolipoic acid. As mentioned above the LipB reaction was recently shown to proceed via an acyl enzyme intermediate (225). The octanoyl group is transferred from the ACP thiol to the thiol of Cys-169. This protein-bound thioester is then attacked by the -amino group of the lipoyl domain lysine to give the modified domain. Octanoyl-ACP + LipB [Octanoyl-LipB] + ACP-SH [Octanoyl-LipB] + Apo Lipoyl Domain * Octanoyl-E2 Domain The fact that LipB could transfer either octanoate or lipoate from ACP to a lipoyl domain raised the question of the true intracellular substrate of the enzyme. This has been answered by overexpression of LipB and isolating the enzyme under conditions that retained any acylenzyme interemediate present. Mass spectrometry showed that only octanoate was attached to the enzyme thereby demonstrating the specificity of the enzyme (226). The reactivity of the cysteine residue seems responsible for the both LipB crystal structure scurrently available, those o.

R less steep rates of change over time (e.g., Curran

R less steep rates of change over time (e.g., Curran, Bauer Willoughby, 2004). Importantly, TICs are assumed to be independent of the passage of time. In other words, the given value of the TIC could in principle be assessed at any time point as this is constant over time. This assumption is sometimes strictly true (e.g., biological sex, country of origin), and at other times, the construct might in principle vary with time but is only assessed at a single time period (e.g., baseline anxiety or initial reaction time). However, growth models can easily be expanded to include the effects of covariates that do vary as a function of time; these are TVC models (Bollen Curran, 2006, pp. 192?98; Raudenbush Bryk, 2002, pp. 179?86; Singer Willett, 2003, pp. 159?88). Whereas TICs directly predict the growth factors (e.g., Bollen Curran, 2006, Figure 5.1), TVCs directly predict the repeated measures while controlling for the influence of the growth factors (e.g., Bollen Curran, 2006, Figure 7.1). Thus, any given repeated measure is jointly determined by the underlying growth factors and the impact of the TVC at that time period. The TVC model can then be expanded to include interactions between the TVCs and time (to T0901317 cancer Thonzonium (bromide) structure assess differences in the magnitude of the TVC effect as a function of time) and interactions between the TVCs and the TICs (to assess differences in the magnitude of the TVC effect as a function of betweenperson characteristics such as gender or ethnicity). Taken together, models can be constructed that simultaneously evaluate within-person influences (via TVCs) and betweenperson influences (via TICs) on stability and change of the outcome over time.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptCAN GROWTH IN TWO CONSTRUCTS BE SIMULTANEOUSLY MODELED OVER TIME?Although the TVC model allows for covariates to change in value over time, it is assumed that the covariates themselves are not characterized by a systematic growth process. For example, say that the repeated outcome was reading ability, and the TVC was number of days of instruction that were missed in a given academic year. It would be reasonable to assume that days of instruction may influence reading ability at a given time point but that there is not a systematic growth process underlying days of instruction missed (that is, children would not be expected to show consistent developmental trends in days missed). However, say instead that the outcome was again reading ability, but the TVC is substance use; in this case, developmental theory would predict that the onset and escalation of substance use itself is characterized by some type of systematic growth function. If so, then the TVC model may be mis-specified and result in biased effects. Both the multilevel and SEM growth frameworks can be expanded to allow for the simultaneous growth of two constructs over time, and this is commonly called a multivariate growth model (Bollen Curran, 2006, chap. 7; MacCallum, Kim, Malarkey, KiecoltGlaser, 1997; McArdle, 1988). Each construct can be characterized by a unique functional form (e.g., one may be linear, the other quadratic), and their relation is examined at the level of the growth factors (e.g., direct estimates of the relation between the intercepts and slopes within and across construct). Finally, these multivariate models can themselves be extendedJ Cogn Dev. Author manuscript; available in PMC 2011 July 7.Curran et al.Pageto inclu.R less steep rates of change over time (e.g., Curran, Bauer Willoughby, 2004). Importantly, TICs are assumed to be independent of the passage of time. In other words, the given value of the TIC could in principle be assessed at any time point as this is constant over time. This assumption is sometimes strictly true (e.g., biological sex, country of origin), and at other times, the construct might in principle vary with time but is only assessed at a single time period (e.g., baseline anxiety or initial reaction time). However, growth models can easily be expanded to include the effects of covariates that do vary as a function of time; these are TVC models (Bollen Curran, 2006, pp. 192?98; Raudenbush Bryk, 2002, pp. 179?86; Singer Willett, 2003, pp. 159?88). Whereas TICs directly predict the growth factors (e.g., Bollen Curran, 2006, Figure 5.1), TVCs directly predict the repeated measures while controlling for the influence of the growth factors (e.g., Bollen Curran, 2006, Figure 7.1). Thus, any given repeated measure is jointly determined by the underlying growth factors and the impact of the TVC at that time period. The TVC model can then be expanded to include interactions between the TVCs and time (to assess differences in the magnitude of the TVC effect as a function of time) and interactions between the TVCs and the TICs (to assess differences in the magnitude of the TVC effect as a function of betweenperson characteristics such as gender or ethnicity). Taken together, models can be constructed that simultaneously evaluate within-person influences (via TVCs) and betweenperson influences (via TICs) on stability and change of the outcome over time.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptCAN GROWTH IN TWO CONSTRUCTS BE SIMULTANEOUSLY MODELED OVER TIME?Although the TVC model allows for covariates to change in value over time, it is assumed that the covariates themselves are not characterized by a systematic growth process. For example, say that the repeated outcome was reading ability, and the TVC was number of days of instruction that were missed in a given academic year. It would be reasonable to assume that days of instruction may influence reading ability at a given time point but that there is not a systematic growth process underlying days of instruction missed (that is, children would not be expected to show consistent developmental trends in days missed). However, say instead that the outcome was again reading ability, but the TVC is substance use; in this case, developmental theory would predict that the onset and escalation of substance use itself is characterized by some type of systematic growth function. If so, then the TVC model may be mis-specified and result in biased effects. Both the multilevel and SEM growth frameworks can be expanded to allow for the simultaneous growth of two constructs over time, and this is commonly called a multivariate growth model (Bollen Curran, 2006, chap. 7; MacCallum, Kim, Malarkey, KiecoltGlaser, 1997; McArdle, 1988). Each construct can be characterized by a unique functional form (e.g., one may be linear, the other quadratic), and their relation is examined at the level of the growth factors (e.g., direct estimates of the relation between the intercepts and slopes within and across construct). Finally, these multivariate models can themselves be extendedJ Cogn Dev. Author manuscript; available in PMC 2011 July 7.Curran et al.Pageto inclu.

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior INK1117MedChemExpress MLN1117 margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.purchase Linaprazan janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of EPZ004777MedChemExpress EPZ004777 emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on get EPZ004777 identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for Aprotinin biological activity adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence Oxaliplatin chemical information across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the Lixisenatide supplier dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive BMS-214662 supplement clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the BAY1217389 site quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health SKF-96365 (hydrochloride) site workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to GGTI298 price regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the L868275 site morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely get Larotrectinib available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction ARRY-470 supplier partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 Bay 41-4109 site temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Mitochondrial division inhibitor 1 chemical information Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Axonomy of learning aims, avoids assessment that rests on low ability.

Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Saroglitazar MagnesiumMedChemExpress Saroglitazar Magnesium Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to BEZ235 price practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also ICG-001 price acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from Citarinostat solubility reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Results: main effectsTo test whether feedback type modulated activation in regions

Results: main effectsTo test whether feedback type modulated purchase Chaetocin activation in regions associated with reward processing during risk taking, we examined individual differences in activation of NAc (based on Haber and Knutson, 2010) and mPFC (based on Op de Macks et al., in press). Results of the ROI analyses showed that, across participants, there was no main effect of feedback type on either NAc or mPFC activation (Supplementary Figure S1). To examine whether other brain regions showed a main effect of feedback type, we conducted order Tyrphostin AG 490 whole-brain analyses for brain activation during risk taking and reward processing separately. Risk taking-related brain activation. Results of the whole-brain analysis across participants (n ?58) for the contrast of Social > Monetary Play revealed clusters of activation in bilateral anterior insula (AI), with the left peak at: x ??8, y ?17, z ?? (cluster-level FWE corrected P ?0.004), and the right peak at: x ?46, y ?22, z ?? (cluster-level FWE corrected P ?0.002) (Figure 4A). These results indicate that bilateral AI was more active during trials on which participants chose to play in the social rank feedback context compared to trials on which participants chose to play in the monetary feedback context. Further examination of the patterns of brain activation in bilateral AI showed that activation in this region was increased forPlay choices–regardless of whether they resulted in Gain or Loss–compared with Pass choices in the social rank feedback context [Gain > Pass: t(57) ?2.9, P ?0.005; Loss > Pass: t(57) ?2.5, P ?0.015], but not in the monetary feedback context (Gain > Pass: t(56) ?0.22, P ?0.83; Loss > Pass: t(56) ?0.78, p ?0.44) (Figure 5A). These findings indicate that bilateral AI distinguished between risky and safe choices when playing for rank, but not when playing for money. Additional clusters of activation were found in left fusiform (peak at: x ??0, y ??2, z ??4, cluster-level FWE corrected P < 0.001) and lingual gyrus (peak at: x ??2, y ??5, z ??, cluster-level FWE corrected P ?0.003). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Play, nor for the contrasts of Social > Monetary Pass and Monetary > Social Pass. Reward-related brain activation. Results of the whole-brain analysis across participants for the contrast of Social > Monetary Gain revealed clusters of activation in left fusiform gyrus (peak at: x ??2, y ??9, z ??1, cluster-level FWE corrected P < .001), and in right AI (peak at: x ?36, y ?16, z ?-6, cluster-level FWE corrected P < 0.001) (Figure 4B). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Gain, nor for the contrasts of Social > Monetary Loss and Monetary > Social Loss. However, at a lowered threshold of P < 0.001 uncorrected with k ! 10 voxels, we found a cluster of activation in left AI (peak at: x ??8, y ?17, z ??) for Social > Monetary Loss (Figure 4C). These results indicate that AI (and fusiform gyrus) was more strongly activated when playing for rank resulted in gains than when playing for money resulted in gains. See Supplementary Figure S2 for the BOLD time-courses of the left and right AI, plotted separately for gain, loss, and pass trials in both the social rank and monetary feedback conditions.Individual differences in AI activationTo test whether pubertal ho.Results: main effectsTo test whether feedback type modulated activation in regions associated with reward processing during risk taking, we examined individual differences in activation of NAc (based on Haber and Knutson, 2010) and mPFC (based on Op de Macks et al., in press). Results of the ROI analyses showed that, across participants, there was no main effect of feedback type on either NAc or mPFC activation (Supplementary Figure S1). To examine whether other brain regions showed a main effect of feedback type, we conducted whole-brain analyses for brain activation during risk taking and reward processing separately. Risk taking-related brain activation. Results of the whole-brain analysis across participants (n ?58) for the contrast of Social > Monetary Play revealed clusters of activation in bilateral anterior insula (AI), with the left peak at: x ??8, y ?17, z ?? (cluster-level FWE corrected P ?0.004), and the right peak at: x ?46, y ?22, z ?? (cluster-level FWE corrected P ?0.002) (Figure 4A). These results indicate that bilateral AI was more active during trials on which participants chose to play in the social rank feedback context compared to trials on which participants chose to play in the monetary feedback context. Further examination of the patterns of brain activation in bilateral AI showed that activation in this region was increased forPlay choices–regardless of whether they resulted in Gain or Loss–compared with Pass choices in the social rank feedback context [Gain > Pass: t(57) ?2.9, P ?0.005; Loss > Pass: t(57) ?2.5, P ?0.015], but not in the monetary feedback context (Gain > Pass: t(56) ?0.22, P ?0.83; Loss > Pass: t(56) ?0.78, p ?0.44) (Figure 5A). These findings indicate that bilateral AI distinguished between risky and safe choices when playing for rank, but not when playing for money. Additional clusters of activation were found in left fusiform (peak at: x ??0, y ??2, z ??4, cluster-level FWE corrected P < 0.001) and lingual gyrus (peak at: x ??2, y ??5, z ??, cluster-level FWE corrected P ?0.003). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Play, nor for the contrasts of Social > Monetary Pass and Monetary > Social Pass. Reward-related brain activation. Results of the whole-brain analysis across participants for the contrast of Social > Monetary Gain revealed clusters of activation in left fusiform gyrus (peak at: x ??2, y ??9, z ??1, cluster-level FWE corrected P < .001), and in right AI (peak at: x ?36, y ?16, z ?-6, cluster-level FWE corrected P < 0.001) (Figure 4B). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Gain, nor for the contrasts of Social > Monetary Loss and Monetary > Social Loss. However, at a lowered threshold of P < 0.001 uncorrected with k ! 10 voxels, we found a cluster of activation in left AI (peak at: x ??8, y ?17, z ??) for Social > Monetary Loss (Figure 4C). These results indicate that AI (and fusiform gyrus) was more strongly activated when playing for rank resulted in gains than when playing for money resulted in gains. See Supplementary Figure S2 for the BOLD time-courses of the left and right AI, plotted separately for gain, loss, and pass trials in both the social rank and monetary feedback conditions.Individual differences in AI activationTo test whether pubertal ho.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took CI-1011MedChemExpress PD-148515 prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 TAPI-2 web Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak 1,1-Dimethylbiguanide hydrochloride chemical information communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) order Oxaliplatin levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the purchase ML240 dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or order Procyanidin B1 otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search DeslorelinMedChemExpress H 4065 Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The H 4065 biological activity Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass T0901317MedChemExpress T0901317 settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more order I-CBP112 distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous RP5264 chemical information studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] Talmapimod web microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 Nutlin (3a)MedChemExpress Nutlin-3a chiral temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early Roc-A web referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the Biotin-VAD-FMK web implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming Sinensetin biological activity knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In ZM241385 price addition IBD’s and experimental murine MK-5172 manufacturer colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Atient preferences and perceptions regarding aggressive treatment. While more white subjects

Atient preferences and perceptions regarding aggressive treatment. While more white subjects MK-571 (sodium salt) price indicated a willingness to participate in a clinical trial involving a new, experimental medication compared to African-Americans, this difference was not statistically significant (80.7 vs 68.7 , P = 0.10). In contrast, more whites than African-Americans were willing to receive CYC if their lupus worsened and if their doctor recommended the treatment (84.9 vs 67.0 , P = 0.02). No significant racial/ethnic differences were observed in the perceptions of effictiveness and risk of CYC. Table 3 buy RG7800 demonstrates patient health attitudes and beliefs. Compared with whites, African-Americans were more likely to believe that prayer is helpful for their lupus (P < 0.001) and to utilize prayer to cope with their disease (P < 0.01). In addition, African-American patients were more likely than whites to believe that their health outcomes are controlled by their own internal actions (P < 0.01) and by powerful others (P < 0.01). They also reported higher trust in physicians than white patients (P = 0.01).Reliability and validity of measuresReliability Supplementary Table S1 (available as supplementary data at Rheumatology Online) shows the Cronbach a coefficient values of several multi-item components of the survey. Correlational analyses Willingness to participate in a clinical trial positively correlated with willingness to receive CYC (r = 0.24, P = 0.001). Perceived effectiveness negatively correlated with perceived risk of CYC treatment (r = ?.32, P < 0.001). Trust in physicians negatively correlated with perceived discrimination in the medical setting (r = ?.60, P < 0.001). Factor analyses The results of the factor analyses are shown in supplementary Table S2 (available as supplementary data at Rheumatology Online). (1) Beliefs about CYC. Effectiveness of treatment items all loaded on Factor 1, which accounted for 70 of the variance. Familiarity with CYC items loaded on Factor 2, which accounted for 23 of the variance. (2) Trust in physicians and perceived discrimination. All trust in physicians items loaded on Factor 1, which accounted for 86 of the variance. All perceived discrimination items loaded on Factor 2, which accounted for 13 of the variance.ResultsA total of 235 SLE patients were initially considered for participation in the study. One hundred and ninety-five were eligible and consented to participate. Data from 120 African-American and 62 white patients were evaluated; 92.3 were women (Fig. 1). Participants' sociodemographic and clinical characteristics are shown in Table 1. Statistically significant differences were observed between the racial/ethnic groups. African-American SLE patients, compared with white SLE patients, were less likely to have more education than a high-school degree (64.2 vs 83.9 , P < 0.01), were less likely to be employed (38.5 vs 56.5 , P = 0.02) and were more likely to have lower incomes (33.6 vs 5.4 with annual income of < 10 000, P < 0.001). Although African-American patients had a higher Charlson Comorbidity Index mean score than white patients (2.34 vs 1.85, P = 0.03), the mean SLEDAI score, SLICC Damage Index score, disease duration and number of immunosuppressant agents used did not differ.Preferences: bivariate analysesTable 4 shows the patient characteristics and beliefs that were significantly related to patients' CYC treatment preference. Compared with SLE patients unwilling to receive the medicati.Atient preferences and perceptions regarding aggressive treatment. While more white subjects indicated a willingness to participate in a clinical trial involving a new, experimental medication compared to African-Americans, this difference was not statistically significant (80.7 vs 68.7 , P = 0.10). In contrast, more whites than African-Americans were willing to receive CYC if their lupus worsened and if their doctor recommended the treatment (84.9 vs 67.0 , P = 0.02). No significant racial/ethnic differences were observed in the perceptions of effictiveness and risk of CYC. Table 3 demonstrates patient health attitudes and beliefs. Compared with whites, African-Americans were more likely to believe that prayer is helpful for their lupus (P < 0.001) and to utilize prayer to cope with their disease (P < 0.01). In addition, African-American patients were more likely than whites to believe that their health outcomes are controlled by their own internal actions (P < 0.01) and by powerful others (P < 0.01). They also reported higher trust in physicians than white patients (P = 0.01).Reliability and validity of measuresReliability Supplementary Table S1 (available as supplementary data at Rheumatology Online) shows the Cronbach a coefficient values of several multi-item components of the survey. Correlational analyses Willingness to participate in a clinical trial positively correlated with willingness to receive CYC (r = 0.24, P = 0.001). Perceived effectiveness negatively correlated with perceived risk of CYC treatment (r = ?.32, P < 0.001). Trust in physicians negatively correlated with perceived discrimination in the medical setting (r = ?.60, P < 0.001). Factor analyses The results of the factor analyses are shown in supplementary Table S2 (available as supplementary data at Rheumatology Online). (1) Beliefs about CYC. Effectiveness of treatment items all loaded on Factor 1, which accounted for 70 of the variance. Familiarity with CYC items loaded on Factor 2, which accounted for 23 of the variance. (2) Trust in physicians and perceived discrimination. All trust in physicians items loaded on Factor 1, which accounted for 86 of the variance. All perceived discrimination items loaded on Factor 2, which accounted for 13 of the variance.ResultsA total of 235 SLE patients were initially considered for participation in the study. One hundred and ninety-five were eligible and consented to participate. Data from 120 African-American and 62 white patients were evaluated; 92.3 were women (Fig. 1). Participants' sociodemographic and clinical characteristics are shown in Table 1. Statistically significant differences were observed between the racial/ethnic groups. African-American SLE patients, compared with white SLE patients, were less likely to have more education than a high-school degree (64.2 vs 83.9 , P < 0.01), were less likely to be employed (38.5 vs 56.5 , P = 0.02) and were more likely to have lower incomes (33.6 vs 5.4 with annual income of < 10 000, P < 0.001). Although African-American patients had a higher Charlson Comorbidity Index mean score than white patients (2.34 vs 1.85, P = 0.03), the mean SLEDAI score, SLICC Damage Index score, disease duration and number of immunosuppressant agents used did not differ.Preferences: bivariate analysesTable 4 shows the patient characteristics and beliefs that were significantly related to patients' CYC treatment preference. Compared with SLE patients unwilling to receive the medicati.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions order Tirabrutinib between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the LDN193189 web multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also PD150606MedChemExpress PD150606 contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a order Pemafibrate stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which LY317615 msds information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:order Litronesib Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Representatives of `health service consumers’ in Uganda were summarised as follows

Representatives of `health service consumers’ in Uganda were summarised as follows:Patients were reportedly uncomfortable and dissatisfied with being handled by low cadre health workers. They wanted to be handled by doctors. They felt bad on learning that the attending health worker was not a doctor. (Uganda, Study #1)Although tasks performed by lower skilled health workers were not always paid through formal mechanisms, some health workers found ways to `cash in’ on their tasks. A study among CHWs in Kenya alluded to volunteer, periurban workers who wished to `acquire skills to sell, because of hard economic times in the country’ (Study # 10). Surgical Assistants in Mozambique were known, at times, to be `obliged to ask for illicit charges’ because of low remuneration relative to the amount of work they performed (Cumbi et al. 2007). Anecdotally, training lay workers in the community in some cases also resulted in untrained individuals posing as health workers and charging for their services (Study # 2, 10, 11). Category 2 ?TS should not be initiated in a health system where existing solutions are available and affordable In certain settings task shifting was seen as a direct threat to job safety and future employment prospects for nurses and doctors. In Uganda (Study # 1, 5), where aIdeally, the views of health workers and policy makers would be triangulated with the views of patients themselves. In the studies reviewed, views of patients and?2016 The Authors. order Leupeptin (hemisulfate) Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?H Mijovic et al.considerable number of doctors and nurses were unemployed or working overseas, task shifting was perceived by some health professionals and policy makers primarily as a short-sighted, cost-saving strategy, effectively pushing established professionals out of the healthcare system.That [task shifting] is an anomaly Uganda cannot afford. As long as we need the professionals, and they are within the country, we should employ them . . . (Senior Manager, Uganda, Study # 5)they are already used to the living conditions of their localities. (District Level buy AICAR Informant, Tanzania, Study # 9)Studies in the review highlighted the tension between health workers assuming new tasks who expected adequate compensation for the work performed and the policy makers who commonly assumed that task shifting was a `cost saving’ strategy. This is an important insight for any taskshifting programme in Kenya that affects nurses. There are many thousands of unemployed nurses in Kenya, and the benefits and limitations of the introduction of a new cadre in neonatal care should be compared to the prospect of employing more nurses in this area. Category 3 ?TS interventions must allow for career planning of all affected cadres Higher skilled cadres, managers and policy makers frequently agreed that compensation of new, lower cadres and opportunities for career progression were inadequate and could potentially compromise the long-term success of task-shifting programmes. The quotes below refer to the newly introduced cadres of M E Officers and Surgical Assistants respectively:They are watching their colleagues moving up the ladder! They are just in one place. Even the good ones . . . we are going to lose them if this trend continues. (Program Officer, Botswana, Study # 8) . . . An individual spends six years in school and continues to be considered mid-level [it’s unjust]. . . There is a huge gap.Representatives of `health service consumers’ in Uganda were summarised as follows:Patients were reportedly uncomfortable and dissatisfied with being handled by low cadre health workers. They wanted to be handled by doctors. They felt bad on learning that the attending health worker was not a doctor. (Uganda, Study #1)Although tasks performed by lower skilled health workers were not always paid through formal mechanisms, some health workers found ways to `cash in’ on their tasks. A study among CHWs in Kenya alluded to volunteer, periurban workers who wished to `acquire skills to sell, because of hard economic times in the country’ (Study # 10). Surgical Assistants in Mozambique were known, at times, to be `obliged to ask for illicit charges’ because of low remuneration relative to the amount of work they performed (Cumbi et al. 2007). Anecdotally, training lay workers in the community in some cases also resulted in untrained individuals posing as health workers and charging for their services (Study # 2, 10, 11). Category 2 ?TS should not be initiated in a health system where existing solutions are available and affordable In certain settings task shifting was seen as a direct threat to job safety and future employment prospects for nurses and doctors. In Uganda (Study # 1, 5), where aIdeally, the views of health workers and policy makers would be triangulated with the views of patients themselves. In the studies reviewed, views of patients and?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?H Mijovic et al.considerable number of doctors and nurses were unemployed or working overseas, task shifting was perceived by some health professionals and policy makers primarily as a short-sighted, cost-saving strategy, effectively pushing established professionals out of the healthcare system.That [task shifting] is an anomaly Uganda cannot afford. As long as we need the professionals, and they are within the country, we should employ them . . . (Senior Manager, Uganda, Study # 5)they are already used to the living conditions of their localities. (District Level Informant, Tanzania, Study # 9)Studies in the review highlighted the tension between health workers assuming new tasks who expected adequate compensation for the work performed and the policy makers who commonly assumed that task shifting was a `cost saving’ strategy. This is an important insight for any taskshifting programme in Kenya that affects nurses. There are many thousands of unemployed nurses in Kenya, and the benefits and limitations of the introduction of a new cadre in neonatal care should be compared to the prospect of employing more nurses in this area. Category 3 ?TS interventions must allow for career planning of all affected cadres Higher skilled cadres, managers and policy makers frequently agreed that compensation of new, lower cadres and opportunities for career progression were inadequate and could potentially compromise the long-term success of task-shifting programmes. The quotes below refer to the newly introduced cadres of M E Officers and Surgical Assistants respectively:They are watching their colleagues moving up the ladder! They are just in one place. Even the good ones . . . we are going to lose them if this trend continues. (Program Officer, Botswana, Study # 8) . . . An individual spends six years in school and continues to be considered mid-level [it’s unjust]. . . There is a huge gap.

Olution. However, this is a 6H+/6e- reaction and cannot occur

Olution. However, this is a 6H+/6e- reaction and cannot occur in one step.243 The energetics of the intermediates are therefore important. Industrially, dinitrogen is reduced to ammonia via the Haber-Bosch GGTI298MedChemExpress GGTI298 process which is carried out at high temperatures and high pressures by an iron catalyst. The high temperature is needed to overcome the kinetic barrier, but makes the reaction less favorable so high pressures are needed. Combining the production of the H2 and the operation of the Haber-Bosch process, it is said that industrial N2-fixation accounts for 1 or more of the total human energy consumption.244 In biology, N2-fixation is accomplished by nitrogenase enzymes in solution at room temperature using reduced ferredoxins and ATP.243 Most biochemical studies and biomimetic models for nitrogen fixation propose sequential single-electron and single-proton transfers to metal-bound nitrogen species, but the thermochemistry of theseNIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagesteps is not experimentally known (only in the Schrock/Yandulov cycle is there good evidence for each of the various intermediates).245,246 Much less is known about the solution thermochemistry of simple NxHyz?species compared with the oxygen analogs. The known aqueous values are provided by Stanbury,247 and Koper has recently reviewed electrochemical studies.248 Dinitrogen is one of the most inert chemical compounds. The addition of a proton or an electron is not very favorable: N2 has a gas phase proton affinity of 5.12 eV, slightly less than methane, and its electron affinity is negative (-1.8 eV).243 The BDE of NN is estimated to be close to or less than 0 kcal/mol (Table 11).249 These values make it unlikely that reduction of free dinitrogen can proceed through a free one-electron reduced species. The two H-atom reduced species of dinitrogen is diazene (HN=NH), also called diimide. Diazene is unstable, as it is powerful H-atom transfer agent with a first BDE of only 60 kcal/mol.49 The Cynaroside cost average gas phase BDFE for Z-diazene to N2 + 2H?is only 19.5 kcal mol-1 (average BDE = 26.7 kcal mol-1), so decomposition to N2 and H2 is very favorable.49 Moreover, diazene is thought to transfer both hydrogens in a concerted fashion to alkenes and alkynes, a very rare example of a 2e-/2H+ reaction.250 Diazene, like dinitrogen, is a very poor base, with a pKa of the conjugate acid of less than zero.251 The reduction of diazene by one H-atom gives the hydrazyl radical (HNNH2), a high-energy species with a very weak N-H bond. Hydrazyl is capable of abstracting an H-atom to yield the more stable hydrazine (H2NNH2) with BDFEaq(H2NNH2) = 83 kcal mol-1. In the gas phase the average BDFE for H2NNH2 to Z-diazene + 2H?is 58.7 kcal mol-1 (average BDE = 66.2 kcal mol-1).49 Like peroxides, hydrazine has a week N bond (BDE = 66.2 kcal mol-1) and can undergo homolytic N bond cleavage as well as PCET reactions. Hydrazine’s lone pairs make it moderately basic, with a first pKa of the conjugate acid similar to the pKa of ammonium, though the addition of a second proton is very unfavorable. 247 Electron transfer oxidation of tetraalkylhydrazines have been examined by Nelsen and others.252 Hydrazine is a powerful, but kinetically slow oxidant, undergoing 2e-/2H+ reduction to give two molecules of ammonium with E?= 1.2 V in acidic aqueous solution. 253 Hydrazine has also been used as a mild.Olution. However, this is a 6H+/6e- reaction and cannot occur in one step.243 The energetics of the intermediates are therefore important. Industrially, dinitrogen is reduced to ammonia via the Haber-Bosch process which is carried out at high temperatures and high pressures by an iron catalyst. The high temperature is needed to overcome the kinetic barrier, but makes the reaction less favorable so high pressures are needed. Combining the production of the H2 and the operation of the Haber-Bosch process, it is said that industrial N2-fixation accounts for 1 or more of the total human energy consumption.244 In biology, N2-fixation is accomplished by nitrogenase enzymes in solution at room temperature using reduced ferredoxins and ATP.243 Most biochemical studies and biomimetic models for nitrogen fixation propose sequential single-electron and single-proton transfers to metal-bound nitrogen species, but the thermochemistry of theseNIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagesteps is not experimentally known (only in the Schrock/Yandulov cycle is there good evidence for each of the various intermediates).245,246 Much less is known about the solution thermochemistry of simple NxHyz?species compared with the oxygen analogs. The known aqueous values are provided by Stanbury,247 and Koper has recently reviewed electrochemical studies.248 Dinitrogen is one of the most inert chemical compounds. The addition of a proton or an electron is not very favorable: N2 has a gas phase proton affinity of 5.12 eV, slightly less than methane, and its electron affinity is negative (-1.8 eV).243 The BDE of NN is estimated to be close to or less than 0 kcal/mol (Table 11).249 These values make it unlikely that reduction of free dinitrogen can proceed through a free one-electron reduced species. The two H-atom reduced species of dinitrogen is diazene (HN=NH), also called diimide. Diazene is unstable, as it is powerful H-atom transfer agent with a first BDE of only 60 kcal/mol.49 The average gas phase BDFE for Z-diazene to N2 + 2H?is only 19.5 kcal mol-1 (average BDE = 26.7 kcal mol-1), so decomposition to N2 and H2 is very favorable.49 Moreover, diazene is thought to transfer both hydrogens in a concerted fashion to alkenes and alkynes, a very rare example of a 2e-/2H+ reaction.250 Diazene, like dinitrogen, is a very poor base, with a pKa of the conjugate acid of less than zero.251 The reduction of diazene by one H-atom gives the hydrazyl radical (HNNH2), a high-energy species with a very weak N-H bond. Hydrazyl is capable of abstracting an H-atom to yield the more stable hydrazine (H2NNH2) with BDFEaq(H2NNH2) = 83 kcal mol-1. In the gas phase the average BDFE for H2NNH2 to Z-diazene + 2H?is 58.7 kcal mol-1 (average BDE = 66.2 kcal mol-1).49 Like peroxides, hydrazine has a week N bond (BDE = 66.2 kcal mol-1) and can undergo homolytic N bond cleavage as well as PCET reactions. Hydrazine’s lone pairs make it moderately basic, with a first pKa of the conjugate acid similar to the pKa of ammonium, though the addition of a second proton is very unfavorable. 247 Electron transfer oxidation of tetraalkylhydrazines have been examined by Nelsen and others.252 Hydrazine is a powerful, but kinetically slow oxidant, undergoing 2e-/2H+ reduction to give two molecules of ammonium with E?= 1.2 V in acidic aqueous solution. 253 Hydrazine has also been used as a mild.

Omeostasis: proopiomelanocortin peptide (POMC) neurons, and neurons coexpressing NPY/AgRP/GABA

Omeostasis: proopiomelanocortin peptide (POMC) neurons, and neurons coexpressing NPY/AgRP/GABA (NAG). NAG neurons are considered critical regulators of feeding and food-seeking behavior (Krashes et al., 2011; Atasoy et al., 2012). Conversely, ablation of NAG neurons in adulthood leads to starvation by a suppression of food consumption (Gropp et al., 2005; Luquet et al., 2005). Activation of POMC neurons in mice, however, suppresses feeding and reduces body weight (Aponte et al., 2011). Both NAG and POMC neurons send axonal projections into the paraventricular nucleus of the hypothalamus (PVH) to regulate food intake (Jobst et al., 2004). Recent studies using optogenetics and pharmacogenetics have supported this hypothesis; for example, activation of NAG neurons led to rapid stimulation of feeding through its actions in the PVH (Atasoy et al., 2012; Krashes et al., 2013). It is well understood that NAG neurons are regulated by hormones, nutrient signals, and synaptic transmission. NAG neuReceived Jan. 7, 2015; revised April 7, 2015; accepted April 29, 2015. Author contributions: A.F.B., M.S.S., and K.L.G. designed research; A.F.B., M.A.K., K.B., and S.J.L. performed research; A.F.B., K.B., M.S.S., and K.L.G. contributed unpublished reagents/analytic tools; A.F.B., K.C.B., S.J.L., M.S.S., and K.L.G. analyzed data; A.F.B., M.A.K., K.C.B., M.S.S., and K.L.G. wrote the paper. This work was supported by Grants P51 OD011092 (ONPRC), R01 HD014643 (M.S.S.), and R01 DK079194 (K.L.G.), and the American Diabetes Association Grant 7-13-MI-06 (A.F.B., K.L.G.). We thank Dr Anda Cornea, and the Imaging and Morphology Core for advice in image analysis. The authors declare no competing financial interests. Correspondence should be addressed to Dr Arian F. Baquero, Division of Diabetes, Obesity, Metabolism, Oregon National Primate Research Center, 505 NW 185 th INK1117 chemical information Avenue, L584, Beaverton, OR 97006-3448. E-mail: [email protected] DOI:10.1523/JNEUROSCI.0058-15.2015 Copyright ?2015 the authors 0270-6474/15/358558-12 15.00/rons receive direct GABAergic (inhibitory) and glutamatergic (excitatory) inputs from others areas of the hypothalamus (Vong et al., 2011; Krashes et al., 2014). Recent evidence suggests that regulation of synaptic transmission onto NAG neurons plays a role in the central control of energy homeostasis (Zeltser et al., 2012). For instance, during fasting, glutamatergic inputs onto NAG neurons are increased to provide an orexigenic drive. As energy replenishment occurs, the number of EPSCs and dendritic spines is reduced in NAG neurons (Yang et al., 2011; Liu et al., 2012). These data suggest that nutrients and hormones can change firing rates of NAG neurons to regulate feeding behavior and body weight. Indeed, leptin-deficient mice have an increase in EPSCs onto NAG neurons (Pinto et al., 2004). Furthermore, synaptic inputs onto NAG neurons are decreased by chronic consumption of calorically dense diets (Horvath et al., 2010). Although modulation of synaptic transmission can alter the function of NAG neurons in the adult, the question remains as to what happens during development. Pups make a transition from BMS-5 web suckling to autonomic feeding behavior during postnatal development. Around P13, rodents initiate ingestion of solid food, and by P21 they are capable of sustaining independent feeding behavior (Swithers, 2003). In the present study, we characterized synaptic inputs onto NAG neurons during these critical periods of development. We also i.Omeostasis: proopiomelanocortin peptide (POMC) neurons, and neurons coexpressing NPY/AgRP/GABA (NAG). NAG neurons are considered critical regulators of feeding and food-seeking behavior (Krashes et al., 2011; Atasoy et al., 2012). Conversely, ablation of NAG neurons in adulthood leads to starvation by a suppression of food consumption (Gropp et al., 2005; Luquet et al., 2005). Activation of POMC neurons in mice, however, suppresses feeding and reduces body weight (Aponte et al., 2011). Both NAG and POMC neurons send axonal projections into the paraventricular nucleus of the hypothalamus (PVH) to regulate food intake (Jobst et al., 2004). Recent studies using optogenetics and pharmacogenetics have supported this hypothesis; for example, activation of NAG neurons led to rapid stimulation of feeding through its actions in the PVH (Atasoy et al., 2012; Krashes et al., 2013). It is well understood that NAG neurons are regulated by hormones, nutrient signals, and synaptic transmission. NAG neuReceived Jan. 7, 2015; revised April 7, 2015; accepted April 29, 2015. Author contributions: A.F.B., M.S.S., and K.L.G. designed research; A.F.B., M.A.K., K.B., and S.J.L. performed research; A.F.B., K.B., M.S.S., and K.L.G. contributed unpublished reagents/analytic tools; A.F.B., K.C.B., S.J.L., M.S.S., and K.L.G. analyzed data; A.F.B., M.A.K., K.C.B., M.S.S., and K.L.G. wrote the paper. This work was supported by Grants P51 OD011092 (ONPRC), R01 HD014643 (M.S.S.), and R01 DK079194 (K.L.G.), and the American Diabetes Association Grant 7-13-MI-06 (A.F.B., K.L.G.). We thank Dr Anda Cornea, and the Imaging and Morphology Core for advice in image analysis. The authors declare no competing financial interests. Correspondence should be addressed to Dr Arian F. Baquero, Division of Diabetes, Obesity, Metabolism, Oregon National Primate Research Center, 505 NW 185 th Avenue, L584, Beaverton, OR 97006-3448. E-mail: [email protected] DOI:10.1523/JNEUROSCI.0058-15.2015 Copyright ?2015 the authors 0270-6474/15/358558-12 15.00/rons receive direct GABAergic (inhibitory) and glutamatergic (excitatory) inputs from others areas of the hypothalamus (Vong et al., 2011; Krashes et al., 2014). Recent evidence suggests that regulation of synaptic transmission onto NAG neurons plays a role in the central control of energy homeostasis (Zeltser et al., 2012). For instance, during fasting, glutamatergic inputs onto NAG neurons are increased to provide an orexigenic drive. As energy replenishment occurs, the number of EPSCs and dendritic spines is reduced in NAG neurons (Yang et al., 2011; Liu et al., 2012). These data suggest that nutrients and hormones can change firing rates of NAG neurons to regulate feeding behavior and body weight. Indeed, leptin-deficient mice have an increase in EPSCs onto NAG neurons (Pinto et al., 2004). Furthermore, synaptic inputs onto NAG neurons are decreased by chronic consumption of calorically dense diets (Horvath et al., 2010). Although modulation of synaptic transmission can alter the function of NAG neurons in the adult, the question remains as to what happens during development. Pups make a transition from suckling to autonomic feeding behavior during postnatal development. Around P13, rodents initiate ingestion of solid food, and by P21 they are capable of sustaining independent feeding behavior (Swithers, 2003). In the present study, we characterized synaptic inputs onto NAG neurons during these critical periods of development. We also i.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the get PD173074 experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on AZD3759 custom synthesis feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As SC144 chemical information depicted in Panel C of OxaliplatinMedChemExpress Oxaliplatin Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s POR-8 structure success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and GW9662 site definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misCyclopamine site represent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was Leupeptin (hemisulfate) site widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Ount of data, say for two or three weeks, is needed

Ount of data, say for two or three weeks, is needed to give a good idea of the sentiment of a Twitter community, and if a drastic change in sentiment does occur within a community, this is a rare event and may indicate that something important has happened to or within the community.NS-018 web community sentiment (MC)1.2 1.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………0.8 0.6 0.4 0.2 0 0.community sentiment (SS) community sentiment (L)0.4 0.2 0 ?.2 ?.4 5.0 4.0 3.0 2.0 1.0Figure 12. The daily mean sentiment in community 2 (Indian politics) from 22 September 2014 to 1 March 2015. Five interesting events are identified.Looking at the daily average sentiment in each community, that is, looking at a higher resolution, more detail is evident. Figure 12 shows the daily mean sentiment in community 2 (Indian politics), also for the period 22 September 2014 to 1 March 2015. Large day-to-day variations can be seen, and we have noticed that often such abrupt changes can be traced to real events affecting the community. In figure 12, we have highlighted five dates where the sentiment measures show spikes or troughs. By examining the tweets sent on those dates we identified the significant event that drove the sentiment change:S 29 ep 2 S 01 06 ep 2 4 O 01 13 ct 2 4 O 01 20 ct 2 4 O 01 27 ct 2 4 O 0 03 ct 14 N 20 10 ov 14 N 20 17 ov 14 N 20 24 ov 14 N 201 o 4 1 v 20 D 14 e 8 c 20 D 1 15 ec 2 4 01 D 22 ec 2 4 D 01 29 ec 2 4 D 01 ec 4 5 20 Ja 1 12 n 2 4 Ja 01 19 n 2 5 Ja 01 26 n 2 5 Ja 015 2 n 20 Fe 1 5 9 b 20 Fe 1 16 b 2 5 F 01 23 eb 2 5 Fe 01 b 5 20– 24 September 2014: India’s Mars Orbiter Mission space probe entered orbit around Mars, and people celebrated. — 23 October 2014: the beginning of the Diwali festival. — 16 December 2014: gunmen affiliated with the Tehrik-i-Taliban conducted a terrorist attack in the northwestern Pakistani city of Peshawar. — 1 January 2014: New Year’s Day. — 7th January 2015: gunmen attacked the offices of the French satirical weekly newspaper Charlie Hebdo in Paris.5. An agent-based model of sentiments dynamics in communitiesIt has been discovered time after time that the collective behaviour of populations of interacting individuals is difficult to understand, challenging to predict and sometimes even seemingly paradoxical. In order to be able to predict the likely evolution of sentiment within a community and to explore its dynamics under various change scenarios, such as the departure of particular users or the arrival of a new vocal user, we built an ABM of our Twitter communities. This includes modelling the sentiment of individuals in the network, and how sentiment spreads from one user to another. The Sulfatinib chemical information agents in the model represent Twitter users, and they are arranged in a static undirected graph; only pairs of agents connected by an edge are able to exchange messages. The simulation proceeds in discrete time steps; the number of these steps per day is a parameter of the model. At each time step the following things happen: — Each agent performs an action which consists of sending a burst of messages to all/some/none of its neighbours, influenced by the agent’s current state. — Each agent evolves into a new state, influenced by the actions of other agents in this step, i.e. influenced by the messages it has received this step. Specifically, an action by an agent consists of: a subset of neighbours who will be messaged at this time step; for each neighbour messaged,.Ount of data, say for two or three weeks, is needed to give a good idea of the sentiment of a Twitter community, and if a drastic change in sentiment does occur within a community, this is a rare event and may indicate that something important has happened to or within the community.community sentiment (MC)1.2 1.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………0.8 0.6 0.4 0.2 0 0.community sentiment (SS) community sentiment (L)0.4 0.2 0 ?.2 ?.4 5.0 4.0 3.0 2.0 1.0Figure 12. The daily mean sentiment in community 2 (Indian politics) from 22 September 2014 to 1 March 2015. Five interesting events are identified.Looking at the daily average sentiment in each community, that is, looking at a higher resolution, more detail is evident. Figure 12 shows the daily mean sentiment in community 2 (Indian politics), also for the period 22 September 2014 to 1 March 2015. Large day-to-day variations can be seen, and we have noticed that often such abrupt changes can be traced to real events affecting the community. In figure 12, we have highlighted five dates where the sentiment measures show spikes or troughs. By examining the tweets sent on those dates we identified the significant event that drove the sentiment change:S 29 ep 2 S 01 06 ep 2 4 O 01 13 ct 2 4 O 01 20 ct 2 4 O 01 27 ct 2 4 O 0 03 ct 14 N 20 10 ov 14 N 20 17 ov 14 N 20 24 ov 14 N 201 o 4 1 v 20 D 14 e 8 c 20 D 1 15 ec 2 4 01 D 22 ec 2 4 D 01 29 ec 2 4 D 01 ec 4 5 20 Ja 1 12 n 2 4 Ja 01 19 n 2 5 Ja 01 26 n 2 5 Ja 015 2 n 20 Fe 1 5 9 b 20 Fe 1 16 b 2 5 F 01 23 eb 2 5 Fe 01 b 5 20– 24 September 2014: India’s Mars Orbiter Mission space probe entered orbit around Mars, and people celebrated. — 23 October 2014: the beginning of the Diwali festival. — 16 December 2014: gunmen affiliated with the Tehrik-i-Taliban conducted a terrorist attack in the northwestern Pakistani city of Peshawar. — 1 January 2014: New Year’s Day. — 7th January 2015: gunmen attacked the offices of the French satirical weekly newspaper Charlie Hebdo in Paris.5. An agent-based model of sentiments dynamics in communitiesIt has been discovered time after time that the collective behaviour of populations of interacting individuals is difficult to understand, challenging to predict and sometimes even seemingly paradoxical. In order to be able to predict the likely evolution of sentiment within a community and to explore its dynamics under various change scenarios, such as the departure of particular users or the arrival of a new vocal user, we built an ABM of our Twitter communities. This includes modelling the sentiment of individuals in the network, and how sentiment spreads from one user to another. The agents in the model represent Twitter users, and they are arranged in a static undirected graph; only pairs of agents connected by an edge are able to exchange messages. The simulation proceeds in discrete time steps; the number of these steps per day is a parameter of the model. At each time step the following things happen: — Each agent performs an action which consists of sending a burst of messages to all/some/none of its neighbours, influenced by the agent’s current state. — Each agent evolves into a new state, influenced by the actions of other agents in this step, i.e. influenced by the messages it has received this step. Specifically, an action by an agent consists of: a subset of neighbours who will be messaged at this time step; for each neighbour messaged,.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be Luteolin 7-O-��-D-glucoside biological activity established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features get NSC309132 described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from FPS-ZM1 price Information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent buy RG7666 signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide purchase ZM241385 reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli Actinomycin D site strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning Biotin-VAD-FMK web outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, Biotin-VAD-FMK supplier University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

On, those willing to receive CYC tended to have higher perceived

On, those willing to BLU-554 custom synthesis receive CYC tended to have higher perceived effectiveness (22.12 vs 17.44, P < 0.001) and lower perceived risk (10.92 vs 11.72, P = 0.05) of treatment. Willingness to receive CYC waswww.rheumatology.oxfordjournals.orgTreatment preferences in lupusTABLE 1 SLE patient sociodemographic and clinical characteristics by racial/ethnic groupCharacteristic Number of subjects, n Age, mean (S.D.), years More than HS graduate, n ( ) Income, n ( ) < 10 000 10 00130 000 30 00150 000 > 50 000 Employed, n ( ) With private medical insurance, n ( ) Married, n ( ) SLEDAI, mean (S.D.) SLICC Damage Index, mean (S.D.) AG-490MedChemExpress AG-490 Charlson Comorbidity, mean (S.D.) CES-D, mean (S.D.)aAfrican-American 120 41.58 (12.70) 77 (64.2) 40 32 23 24 46 42 37 3.32 2.02 2.34 19.48 (33.6) (26.9) (19.3) (20.2) (38.5) (35.0) (30.8) (3.39) (2.19) (1.43) (12.26)White 62 45.24 (11.94) 52 (83.9) 3 5 10 38 35 52 41 2.95 1.71 1.85 15.92 (5.4) (8.9) (17.9) (67.9) (56.5) (83.9) (66.1) (2.71) (2.56) (1.28) (12.32)P-valuea0.06 <0.01 <0.0.02 <0.001 <0.001 0.52 0.22 0.03 0.Significance level of the w2 (or Fisher's exact) statistic for categorical variables and two-tailed t-test (or Wilcoxon's rank sum test) for continuous variables. HS: high school.TABLE 2 SLE patient preferences and perceptions regarding aggressive treatmentAfrican-American Willing to receive CYC, n ( )b Familiarity, mean (S.D.) Perception of effectiveness, mean (S.D.) Perception of risk, mean (S.D.) Willing to participate in a clinical trial involving a new medication, n ( )caWhite 45 0.57 21.25 11.11 46 (84.9) (0.82) (4.27) (2.33) (80.7)P-valuea 0.02 0.10 0.44 0.95 0.63 0.36 20.67 11.14(67.0) (0.67) (4.37) (2.11) (68.7)Significance level of the w2 statistic for categorical variables and two-tailed t-test (or Wilcoxon's rank sum test) for continuous variables. bAmong patients who had never received CYC (n = 147, 94 African-American and 53 white). cAmong patients who had never participated in a clinical trial involving a new medication (n = 172, 115 African-American and 57 white).also significantly associated with a higher trust in physicians score (39.08 vs 35.79, P = 0.03), but not with physician PDM style score, locus of control or perceived discrimination in medicine. Married patients were more willing than single, divorced or widowed patients to participate in a clinical trial involving an experimental medication (80.8 vs 66.7 , P = 0.04). Willingness to participate in a clinical trial was also associated with having a lower internal locus of control score (24.75 vs 26.74, P = 0.03) and believing that having a rheumatologist of the same race (P = 0.02) and age (P = 0.05) are very unimportant. Those willing to participate in a clinical trial also had a significantly higher perceived physician PDM style mean score (72.20 vs 56.74, P < 0.001). Yet, clinical trial participation was unrelated to physicianpatient relationship duration, trust in physicians or perceived discrimination.of the odds of willingness to receive CYC: AfricanAmerican race [odds ratio (OR) 0.29, 95 CI 0.10, 0.80)], trust in physicians (OR 1.05, 95 CI 1.00, 1.12) and perceptions of effectiveness of CYC (OR 1.40, 95 CI 1.22, 1.61). Similarly, a separate logistic regression analysis demonstrated that the following were significant determinants of the odds of willingness to participate in a clinical trial: internal health locus of control (OR 0.93, 95 CI 0.86, 0.99), physician PDM style (OR 1.03, 95 CI 1.01, 1.04), lack of physician ra.On, those willing to receive CYC tended to have higher perceived effectiveness (22.12 vs 17.44, P < 0.001) and lower perceived risk (10.92 vs 11.72, P = 0.05) of treatment. Willingness to receive CYC waswww.rheumatology.oxfordjournals.orgTreatment preferences in lupusTABLE 1 SLE patient sociodemographic and clinical characteristics by racial/ethnic groupCharacteristic Number of subjects, n Age, mean (S.D.), years More than HS graduate, n ( ) Income, n ( ) < 10 000 10 00130 000 30 00150 000 > 50 000 Employed, n ( ) With private medical insurance, n ( ) Married, n ( ) SLEDAI, mean (S.D.) SLICC Damage Index, mean (S.D.) Charlson Comorbidity, mean (S.D.) CES-D, mean (S.D.)aAfrican-American 120 41.58 (12.70) 77 (64.2) 40 32 23 24 46 42 37 3.32 2.02 2.34 19.48 (33.6) (26.9) (19.3) (20.2) (38.5) (35.0) (30.8) (3.39) (2.19) (1.43) (12.26)White 62 45.24 (11.94) 52 (83.9) 3 5 10 38 35 52 41 2.95 1.71 1.85 15.92 (5.4) (8.9) (17.9) (67.9) (56.5) (83.9) (66.1) (2.71) (2.56) (1.28) (12.32)P-valuea0.06 <0.01 <0.0.02 <0.001 <0.001 0.52 0.22 0.03 0.Significance level of the w2 (or Fisher's exact) statistic for categorical variables and two-tailed t-test (or Wilcoxon's rank sum test) for continuous variables. HS: high school.TABLE 2 SLE patient preferences and perceptions regarding aggressive treatmentAfrican-American Willing to receive CYC, n ( )b Familiarity, mean (S.D.) Perception of effectiveness, mean (S.D.) Perception of risk, mean (S.D.) Willing to participate in a clinical trial involving a new medication, n ( )caWhite 45 0.57 21.25 11.11 46 (84.9) (0.82) (4.27) (2.33) (80.7)P-valuea 0.02 0.10 0.44 0.95 0.63 0.36 20.67 11.14(67.0) (0.67) (4.37) (2.11) (68.7)Significance level of the w2 statistic for categorical variables and two-tailed t-test (or Wilcoxon's rank sum test) for continuous variables. bAmong patients who had never received CYC (n = 147, 94 African-American and 53 white). cAmong patients who had never participated in a clinical trial involving a new medication (n = 172, 115 African-American and 57 white).also significantly associated with a higher trust in physicians score (39.08 vs 35.79, P = 0.03), but not with physician PDM style score, locus of control or perceived discrimination in medicine. Married patients were more willing than single, divorced or widowed patients to participate in a clinical trial involving an experimental medication (80.8 vs 66.7 , P = 0.04). Willingness to participate in a clinical trial was also associated with having a lower internal locus of control score (24.75 vs 26.74, P = 0.03) and believing that having a rheumatologist of the same race (P = 0.02) and age (P = 0.05) are very unimportant. Those willing to participate in a clinical trial also had a significantly higher perceived physician PDM style mean score (72.20 vs 56.74, P < 0.001). Yet, clinical trial participation was unrelated to physicianpatient relationship duration, trust in physicians or perceived discrimination.of the odds of willingness to receive CYC: AfricanAmerican race [odds ratio (OR) 0.29, 95 CI 0.10, 0.80)], trust in physicians (OR 1.05, 95 CI 1.00, 1.12) and perceptions of effectiveness of CYC (OR 1.40, 95 CI 1.22, 1.61). Similarly, a separate logistic regression analysis demonstrated that the following were significant determinants of the odds of willingness to participate in a clinical trial: internal health locus of control (OR 0.93, 95 CI 0.86, 0.99), physician PDM style (OR 1.03, 95 CI 1.01, 1.04), lack of physician ra.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified MK-1439 biological activity spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and (Z)-4-Hydroxytamoxifen mechanism of action closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing NS-018 price individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or GSK2256098 web defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.

Weighted more heavily than observations with a smaller number of data

Weighted more heavily than observations with a smaller number of data points. The second approach is called multiple imputation, and the growth model is estimated in a two-stage sequence (Rubin, 1987; Schafer, 1999). In the first stage, the missing data points are imputed based upon the characteristics of the non-missing data points, and this is done multiple times (typically 5 to 10 times). In the second stage, the growth model is fitted separately to each of the imputed data sets, and the results are pooled into a final set of estimates. Although extremely flexible, both approaches invoke explicit assumptions about the nature of missing data. Specifically, the missing data must be characterized as missing completely at random (e.g., cases are truly missing at random) or missing at random (e.g., cases are missing as a function of measured characteristics such as gender or ethnicity). Importantly, data that are missing not at random (e.g., cases are missing as a direct function of unmeasured characteristics such as the very value that is missing) cannot be included in standard growth modeling applications, and much more NIK333MedChemExpress NIK333 complex procedures are required (e.g., Heckman, 1976; Rubin, 1988).WHAT ARE THE DIFFERENT SHAPES OF GROWTH CURVES THAT CAN BE MODELED?A critically important first step in any growth model is the identification of the optimal functional form of the trajectory over time; that is, it must be established exactly how the repeated measures change as a function of time. If the incorrect functional form is used as the basis for the initial growth model, then expanding this model to include complexities such as predictors of growth or multiple group analysis will likely lead to biased results. TheJ Cogn Dev. Author manuscript; available in PMC 2011 July 7.Curran et al.Pagemost basic form of growth is a random intercept-only model; this implies that there is a stable Thonzonium (bromide) msds overall level of the repeatedly measured construct over time and individuals vary randomly around this overall level at any given time point. It may seem an oxymoron to call an intercept-only model “growth,” but this is consistent with the notion of a trajectory that is simply flat with respect to time. This intercept-only model can then be expanded in a variety of directions. The most straightforward method is to consider the family of polynomial functions; examples include a straight line, a quadratic curve, and a cubic curve. Polynomials are widely used given that these can be easily estimated within either the SEM or multilevel frameworks. Other more complex functional forms are possible including entire families of interesting exponential trajectories (e.g., monomolecular, logistic; Cudeck Harring, 2007). However, a variety of complications arise when incorporating these types of trajectories, because the parameters enter the model nonlinearly, making model estimation substantially more difficult, if not at times impossible. A flexible alternative is to use piecewise linear modeling to approximate complex nonlinear functions in which two or more linear trajectories are joined together to correspond to a potentially intractable nonlinear function (Bollen Curran, 2006, pp. 103?06; Raudenbush Bryk, 2002, pp. 178?79; Singer Willett, 2003, pp. 207?08). A final option is a fully latent curve model available within the SEM framework in which some or all of the loadings on the slope factor are freely estimated so that change optimally corresponds to the unique c.Weighted more heavily than observations with a smaller number of data points. The second approach is called multiple imputation, and the growth model is estimated in a two-stage sequence (Rubin, 1987; Schafer, 1999). In the first stage, the missing data points are imputed based upon the characteristics of the non-missing data points, and this is done multiple times (typically 5 to 10 times). In the second stage, the growth model is fitted separately to each of the imputed data sets, and the results are pooled into a final set of estimates. Although extremely flexible, both approaches invoke explicit assumptions about the nature of missing data. Specifically, the missing data must be characterized as missing completely at random (e.g., cases are truly missing at random) or missing at random (e.g., cases are missing as a function of measured characteristics such as gender or ethnicity). Importantly, data that are missing not at random (e.g., cases are missing as a direct function of unmeasured characteristics such as the very value that is missing) cannot be included in standard growth modeling applications, and much more complex procedures are required (e.g., Heckman, 1976; Rubin, 1988).WHAT ARE THE DIFFERENT SHAPES OF GROWTH CURVES THAT CAN BE MODELED?A critically important first step in any growth model is the identification of the optimal functional form of the trajectory over time; that is, it must be established exactly how the repeated measures change as a function of time. If the incorrect functional form is used as the basis for the initial growth model, then expanding this model to include complexities such as predictors of growth or multiple group analysis will likely lead to biased results. TheJ Cogn Dev. Author manuscript; available in PMC 2011 July 7.Curran et al.Pagemost basic form of growth is a random intercept-only model; this implies that there is a stable overall level of the repeatedly measured construct over time and individuals vary randomly around this overall level at any given time point. It may seem an oxymoron to call an intercept-only model “growth,” but this is consistent with the notion of a trajectory that is simply flat with respect to time. This intercept-only model can then be expanded in a variety of directions. The most straightforward method is to consider the family of polynomial functions; examples include a straight line, a quadratic curve, and a cubic curve. Polynomials are widely used given that these can be easily estimated within either the SEM or multilevel frameworks. Other more complex functional forms are possible including entire families of interesting exponential trajectories (e.g., monomolecular, logistic; Cudeck Harring, 2007). However, a variety of complications arise when incorporating these types of trajectories, because the parameters enter the model nonlinearly, making model estimation substantially more difficult, if not at times impossible. A flexible alternative is to use piecewise linear modeling to approximate complex nonlinear functions in which two or more linear trajectories are joined together to correspond to a potentially intractable nonlinear function (Bollen Curran, 2006, pp. 103?06; Raudenbush Bryk, 2002, pp. 178?79; Singer Willett, 2003, pp. 207?08). A final option is a fully latent curve model available within the SEM framework in which some or all of the loadings on the slope factor are freely estimated so that change optimally corresponds to the unique c.

Anned start and need of urgent dialysis start. Population n Cause

Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) RG7666 price Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) XL880 dose patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from Grazoprevir site reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at get CCX282-B elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode Pristinamycin IA web compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan SCR7 clinical trials distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression Vadadustat cost analyses to understand the prediction performance for patient AG-490 chemical information variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the TAPI-2 custom synthesis unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: buy Necrosulfonamide Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive Pan-RAS-IN-1MedChemExpress Pan-RAS-IN-1 NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence PD150606 mechanism of action across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, buy Vasoactive Intestinal Peptide (human, rat, mouse, rabbit, canine, porcine) January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, ML240 site distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of buy Pamapimod healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals order GS-5816 provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

He free radical chemistry of ROOH containing systems can proceed either

He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET Caspase-3 InhibitorMedChemExpress Z-DEVD-FMK reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Cycloheximide solubility nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning SCR7 site outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. LLY-507 side effects Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile Avasimibe web collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move Stattic chemical information coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ith grade. No systematic associations were observed between agentic goals and

Ith grade. No systematic associations were observed between agentic goals and alcohol use (6th grade: r=.02, 7th grade: r=.17, 8th grade: r=.04, 9th grade: r=.11) and the strength of the association between communal goals and alcohol use decreased with grade (6th grade: r=.22, 7th grade: r=.13, 8th grade: r=.04, 9th grade: r=.-.03).Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageMultilevel ModelsAuthor get 3-MA Manuscript Author Manuscript Author Manuscript Author ManuscriptThe gender interaction terms did not significantly improve model fit (2 [8, N=386]=5.16, p>.05), and were not considered further. However, the first-order effect of gender was included as a statistical control variable in models testing grade interaction terms. A nested chi-square test comparing a model with and without the hypothesized interaction terms with grade suggested that model fit improved with the inclusion of twoway (2 [8, N=386]=18.25, p<.05) and three-way (2 [4, N=386]=11.21, p<.05) interactions. As shown in Table 1, significant three-way interaction terms were found for grade ?descriptive norm ?communal goals (B =-0.33, p=.03), grade ?injunctive norms ?communal goals (B =0.30, p=.03), and grade ?descriptive norms ?agentic goals (B=0.24, p=.04). The grade ?injunctive norms ?agentic goals three-way interaction term was not statistically significant (B =-0.15, p=.30). To facilitate interpretation of the three-way interaction terms, simple slopes of norms by levels of social goals were plotted for an early (6th variables predicting 7th grade alcohol use) and late (9th grade variables predicting 10 grade alcohol use) cross-lag (see Figure 1). Descriptive Norms Descriptive Norms and Agentic Goals As seen in Panel A of Figure 1, for adolescents in the 6th grade, descriptive norms were not found to significantly predict 7th grade alcohol use for adolescents with high or low levels of agentic goals (OR=0.86 and 1.71, respectively, both ps>.05). High levels of descriptive norms in the 9th grade were AZD4547 biological activity associated with increased probability of alcohol use in the 10th grade for adolescents with high (OR=2.43 p<.05), but not low (OR=1.09, p>.05) levels of agentic goals. This pattern provides partial support for the hypothesized interaction between descriptive norms, agentic goals and grade. That is, there was a shift in the moderating role of agentic social goals with grade, such that descriptive norms became a predictor of alcohol use for youth characterized by strong agentic goals, but only in later grades. Descriptive Norms and Communal Goals High levels of descriptive norms in the 6th grade were associated with increased probability of alcohol use in the 7th grade for adolescents characterized by high (OR=2.07, p<.05) but not low (OR=0.72, p>.05) levels of communal goals. As seen in Panel 2 of Figure 1, in later grades, this pattern reversed itself, such that 9th grade descriptive norms were not associated with 10th grade drinking for adolescents high in communal goals (OR=0.72, p>.05), but they were associated with 10th grade drinking for adolescents low in communal goals (OR=2.58, p>.05). Although descriptive norms were not hypothesized to interact with communal goals, these findings suggest a developmental shift such that in early adolescence, descriptive norms influence alcohol use for those characterized by strong communal goals whereas in later adolescence descriptive norms influence alcohol use for adolescents character.Ith grade. No systematic associations were observed between agentic goals and alcohol use (6th grade: r=.02, 7th grade: r=.17, 8th grade: r=.04, 9th grade: r=.11) and the strength of the association between communal goals and alcohol use decreased with grade (6th grade: r=.22, 7th grade: r=.13, 8th grade: r=.04, 9th grade: r=.-.03).Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageMultilevel ModelsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptThe gender interaction terms did not significantly improve model fit (2 [8, N=386]=5.16, p>.05), and were not considered further. However, the first-order effect of gender was included as a statistical control variable in models testing grade interaction terms. A nested chi-square test comparing a model with and without the hypothesized interaction terms with grade suggested that model fit improved with the inclusion of twoway (2 [8, N=386]=18.25, p<.05) and three-way (2 [4, N=386]=11.21, p<.05) interactions. As shown in Table 1, significant three-way interaction terms were found for grade ?descriptive norm ?communal goals (B =-0.33, p=.03), grade ?injunctive norms ?communal goals (B =0.30, p=.03), and grade ?descriptive norms ?agentic goals (B=0.24, p=.04). The grade ?injunctive norms ?agentic goals three-way interaction term was not statistically significant (B =-0.15, p=.30). To facilitate interpretation of the three-way interaction terms, simple slopes of norms by levels of social goals were plotted for an early (6th variables predicting 7th grade alcohol use) and late (9th grade variables predicting 10 grade alcohol use) cross-lag (see Figure 1). Descriptive Norms Descriptive Norms and Agentic Goals As seen in Panel A of Figure 1, for adolescents in the 6th grade, descriptive norms were not found to significantly predict 7th grade alcohol use for adolescents with high or low levels of agentic goals (OR=0.86 and 1.71, respectively, both ps>.05). High levels of descriptive norms in the 9th grade were associated with increased probability of alcohol use in the 10th grade for adolescents with high (OR=2.43 p<.05), but not low (OR=1.09, p>.05) levels of agentic goals. This pattern provides partial support for the hypothesized interaction between descriptive norms, agentic goals and grade. That is, there was a shift in the moderating role of agentic social goals with grade, such that descriptive norms became a predictor of alcohol use for youth characterized by strong agentic goals, but only in later grades. Descriptive Norms and Communal Goals High levels of descriptive norms in the 6th grade were associated with increased probability of alcohol use in the 7th grade for adolescents characterized by high (OR=2.07, p<.05) but not low (OR=0.72, p>.05) levels of communal goals. As seen in Panel 2 of Figure 1, in later grades, this pattern reversed itself, such that 9th grade descriptive norms were not associated with 10th grade drinking for adolescents high in communal goals (OR=0.72, p>.05), but they were associated with 10th grade drinking for adolescents low in communal goals (OR=2.58, p>.05). Although descriptive norms were not hypothesized to interact with communal goals, these findings suggest a developmental shift such that in early adolescence, descriptive norms influence alcohol use for those characterized by strong communal goals whereas in later adolescence descriptive norms influence alcohol use for adolescents character.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the C.I. 75535MedChemExpress Isoarnebin 4 services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business Ornipressin web situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, R1503 chemical information especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the Leupeptin (hemisulfate) web studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of CibinetideMedChemExpress Cibinetide zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual XR9576 site merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant Larotrectinib custom synthesis literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for Torin 1 biological activity exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a get Ciclosporin polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera PP58 dose species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.

Situation, most likely increasing morbidity, mortality and the cost of RRT

Situation, most likely increasing morbidity, mortality and the cost of RRT [21,30?1]. To our knowledge, this is the first evaluation of type of referral, dialysis start and modality choice on RRT described in Eastern Europe. Over the past several years, interest has evolved in evaluating the timing of nephrology referral in the predialytic stage of CKD as an important variable related to prognosis. Late referral to predialysis care and its quality may influence the selection of dialysis modality as well as the timing and planning of dialysis start [19,23,30?4]. The definition of the time TAK-385 site factor “late” is somewhat arbitrary and varies in the literature, ranging from less than 1 month to less than 6 months follow-up before RRT is started. Early referral to ICS was defined as at least a 3-month follow-up within the clinics’ care before starting RRT. However, at least one year is usually required to educate and optimize the preparation for RRT [13,32?4]. There are wide differences between different centers and countries in late referrals [35?6]. In Spain, Italy and France, data show that 20?5 of patients experienced late referrals, while higher figures are reported for other countries [36?42]. The relatively low involvement of nephrologists since initiation of CKD follow-up (48 ) compared with other series [23] may partially explain the high level of late referral. Late referral may deprive the patient from treatment to prevent or delay CKD progression and access to kidney transplantation, and inevitably lowers the possibility of receiving education, as well as choice options [11,32,43]. Numerous factors may be involved in a NP start, although some are unpredictable and others unacceptable/undesirable: asymptomatic renal disease (unpredictable), inadequate diagnosis or treatment of CKD (unacceptable), unexpected rapid deterioration of renal function, socio-economic reasons, patients reluctant to initiate dialysis or whose physicians underestimate the potential benefits of dialysis, long waiting lists to attend a predialysis care unit (unacceptable), waiting list for performing RP54476 chemical information Vascular access (unacceptable or undesirable) and others [23,41?4]. To our knowledge only one earlier study has covered the real reasons behind anPLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,8 /Referral, Modality and Dialysis Start in an International SettingTable 5. Clinical characteristics according to initial RRT modality. Population n Group: n ( ) ER+P ER+NP LR+P LR+NP Gender, Male, n ( ) Age at dialysis start < 35 years, n ( ) 35?0 years, n ( ) 51?5 years, n ( ) 66?5 years, n ( ) > 75 years, n ( ) Cause of ESRD Diabetes mellitus, n ( ) Glomerular, n ( ) Inherited, n ( ) Unknown, n ( ) Others, n ( ) Tubulo-interstitial, n ( ) Vascular, n ( ) Followed at initiation of CKD care by Nephrologist, n ( ) Time since initiation of CKD care to dialysis start (m.) Patient followed in predialysis (GFR<30 ml/min), n ( ) Patient followed by specialized predialysis staff, n ( ) Patient educated in modalities, n ( ) 162 (30) 64 (12) 26 (4) 52 (9) 56 (10) 62 (11) 125 (23) 264 (48) 12.3 (0.3?5) 332 (60) 160 (29) 436 (80) 143 (29) 52 (11) 21 (4) 49 (10) 51 (10) 57 (12) 115 (24) 230 (47) 12.8 (0.26?8) 288 (59) 145 (30) 382 (78) 19 (32) 12 (20) 5 (8) 3 (5) 5 (8) 5 (8) 10 (17) 34 (58) 10.0 (0.3?9) 44 (75) 15 (25) 54 (92) 0.02 0.54 0.02 0.13 0.45 0.18 21 (4) 66 (12) 186 (34) 127 (23) 147 (27) 16 (4) 48 (10) 166 (34) 119 (24) 139 (28) 5 (8) 18 (30) 20 (34) 8 (14) 8 (14) <0.001 16.Situation, most likely increasing morbidity, mortality and the cost of RRT [21,30?1]. To our knowledge, this is the first evaluation of type of referral, dialysis start and modality choice on RRT described in Eastern Europe. Over the past several years, interest has evolved in evaluating the timing of nephrology referral in the predialytic stage of CKD as an important variable related to prognosis. Late referral to predialysis care and its quality may influence the selection of dialysis modality as well as the timing and planning of dialysis start [19,23,30?4]. The definition of the time factor "late" is somewhat arbitrary and varies in the literature, ranging from less than 1 month to less than 6 months follow-up before RRT is started. Early referral to ICS was defined as at least a 3-month follow-up within the clinics' care before starting RRT. However, at least one year is usually required to educate and optimize the preparation for RRT [13,32?4]. There are wide differences between different centers and countries in late referrals [35?6]. In Spain, Italy and France, data show that 20?5 of patients experienced late referrals, while higher figures are reported for other countries [36?42]. The relatively low involvement of nephrologists since initiation of CKD follow-up (48 ) compared with other series [23] may partially explain the high level of late referral. Late referral may deprive the patient from treatment to prevent or delay CKD progression and access to kidney transplantation, and inevitably lowers the possibility of receiving education, as well as choice options [11,32,43]. Numerous factors may be involved in a NP start, although some are unpredictable and others unacceptable/undesirable: asymptomatic renal disease (unpredictable), inadequate diagnosis or treatment of CKD (unacceptable), unexpected rapid deterioration of renal function, socio-economic reasons, patients reluctant to initiate dialysis or whose physicians underestimate the potential benefits of dialysis, long waiting lists to attend a predialysis care unit (unacceptable), waiting list for performing vascular access (unacceptable or undesirable) and others [23,41?4]. To our knowledge only one earlier study has covered the real reasons behind anPLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,8 /Referral, Modality and Dialysis Start in an International SettingTable 5. Clinical characteristics according to initial RRT modality. Population n Group: n ( ) ER+P ER+NP LR+P LR+NP Gender, Male, n ( ) Age at dialysis start < 35 years, n ( ) 35?0 years, n ( ) 51?5 years, n ( ) 66?5 years, n ( ) > 75 years, n ( ) Cause of ESRD Diabetes mellitus, n ( ) Glomerular, n ( ) Inherited, n ( ) Unknown, n ( ) Others, n ( ) Tubulo-interstitial, n ( ) Vascular, n ( ) Followed at initiation of CKD care by Nephrologist, n ( ) Time since initiation of CKD care to dialysis start (m.) Patient followed in predialysis (GFR<30 ml/min), n ( ) Patient followed by specialized predialysis staff, n ( ) Patient educated in modalities, n ( ) 162 (30) 64 (12) 26 (4) 52 (9) 56 (10) 62 (11) 125 (23) 264 (48) 12.3 (0.3?5) 332 (60) 160 (29) 436 (80) 143 (29) 52 (11) 21 (4) 49 (10) 51 (10) 57 (12) 115 (24) 230 (47) 12.8 (0.26?8) 288 (59) 145 (30) 382 (78) 19 (32) 12 (20) 5 (8) 3 (5) 5 (8) 5 (8) 10 (17) 34 (58) 10.0 (0.3?9) 44 (75) 15 (25) 54 (92) 0.02 0.54 0.02 0.13 0.45 0.18 21 (4) 66 (12) 186 (34) 127 (23) 147 (27) 16 (4) 48 (10) 166 (34) 119 (24) 139 (28) 5 (8) 18 (30) 20 (34) 8 (14) 8 (14) <0.001 16.

Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines

Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines, and Culture ConditionsThe non-pathogenic murine E. coli strain NC101 was isolated as described previously[24]. E. coli strain O157:H7 was a kind gift from Dr. Ann Matthysse at UNC, Chapel Hill. E. coli were grown in Luria-Burtani (LB) broth at 37 with shaking at 250 rpm. The J774 murine macrophage and L929 fibroblast cell lines were originally obtained from ATCC (Manassas, VA) and cultured in RPMI ICG-001 supplement containing 10 fetal bovine serum (FBS), 100U/mL penicillin, 1000 g/mL streptomycin, and 10mM glutamine in 37 humidified incubators with 5 CO2. Conditioned media from L929 cells was used as a source of macrophage colony stimulating factor (M-CSF) for the production of bone marrow-derived macrophages (BMDMs) and was made as described previously[25]. The mutant E. coli NC101 strain lacking ibpA and ibpB (NC101ibpAB) that was used in this study had been generated previously using the -red recombinase method[23,26]. We used identical methods to create a mutant E. coli O157:H7 strain that lacks ibpA and ibpB (O157: H7ibpAB). However, since the pCP20 plasmid encoding Flp recombinase failed to induce recombination at the FRT sites in E. coli O157:H7, we used strains of NC101ibpAB and O157: H7ibpAB that still contained the kanamycin resistance gene. Mutant E. coli NC101 lacking oxyS (NC101oxyS) was also generated using the -red recombinase method. Primers 5’GCATAGCAACGAACGATTATCCCTATCAAGCATTCTGACTGTGTAGGCTGGAGCTGCTTC and 5′ ACCGTTACTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATCATATGAATATCCTCCTTAGTTCC were used to amplify the kanamycin resistance cassette from pKD4. Transformation and site-specific recombination of the PCR product into the oxyS locus on the E. coli NC101 chromosome followed by excision of the kanamycin resistance gene using pCP20 was performed as previously described[23,26]. Recombinant bacterial cell lines were generated in accordance with procedures outlined by the Environmental Health and Safety Department at University of North Carolina at Chapel Hill.Mouse Strains and Production of Bone Marrow-Derived MacrophagesWild-type, gp91phox-/-, and Inos-/- mice (all on the C57/B6 genetic background) were originally obtained from Jackson Laboratories and maintained in specific-pathogen-free conditions in Department of Lab and Animal Medicine facilities at UNC, Chapel Hill. All animal protocols were JNJ-26481585 site approved by the UNC-Chapel Hill Institutional Animal Care and Use Committee. Bone marrow derived macrophages (BMDMs) were obtained similar to methods described previously[27]. Briefly, bone marrow was harvested from femurs and tibias of mice by flushing marrow cavities with sterile RPMI through a 26G needle and red cells lysed with 0.8 ammonium chloride for 5 minutes. After washing twice with RPMI containing 10 FBS, 2.5 x 107 cells/ plate were added to 25cm petri dishes in 50mL RPMI/10 FBS/100U/mL penicillin/ 1000 g/ mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media. Three days later, 10mL of RPMI/10 FBS/100U/mL penicillin/ 1000 g/mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media was added to each plate. On day 6, adherent cells (BMDMs) were removed with TrypLE-Express (Invitrogen), counted, and plated into experimental wells.Gentamicin Protection AssaysIntra-macrophage bacterial survival assays were performed as described previously[14,23]. Briefly, approximately 10 mid-log phase bacteria/cell were added to 5?.5 x 105 BMDMs/well in 12-well plates in a tot.Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines, and Culture ConditionsThe non-pathogenic murine E. coli strain NC101 was isolated as described previously[24]. E. coli strain O157:H7 was a kind gift from Dr. Ann Matthysse at UNC, Chapel Hill. E. coli were grown in Luria-Burtani (LB) broth at 37 with shaking at 250 rpm. The J774 murine macrophage and L929 fibroblast cell lines were originally obtained from ATCC (Manassas, VA) and cultured in RPMI containing 10 fetal bovine serum (FBS), 100U/mL penicillin, 1000 g/mL streptomycin, and 10mM glutamine in 37 humidified incubators with 5 CO2. Conditioned media from L929 cells was used as a source of macrophage colony stimulating factor (M-CSF) for the production of bone marrow-derived macrophages (BMDMs) and was made as described previously[25]. The mutant E. coli NC101 strain lacking ibpA and ibpB (NC101ibpAB) that was used in this study had been generated previously using the -red recombinase method[23,26]. We used identical methods to create a mutant E. coli O157:H7 strain that lacks ibpA and ibpB (O157: H7ibpAB). However, since the pCP20 plasmid encoding Flp recombinase failed to induce recombination at the FRT sites in E. coli O157:H7, we used strains of NC101ibpAB and O157: H7ibpAB that still contained the kanamycin resistance gene. Mutant E. coli NC101 lacking oxyS (NC101oxyS) was also generated using the -red recombinase method. Primers 5’GCATAGCAACGAACGATTATCCCTATCAAGCATTCTGACTGTGTAGGCTGGAGCTGCTTC and 5′ ACCGTTACTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATCATATGAATATCCTCCTTAGTTCC were used to amplify the kanamycin resistance cassette from pKD4. Transformation and site-specific recombination of the PCR product into the oxyS locus on the E. coli NC101 chromosome followed by excision of the kanamycin resistance gene using pCP20 was performed as previously described[23,26]. Recombinant bacterial cell lines were generated in accordance with procedures outlined by the Environmental Health and Safety Department at University of North Carolina at Chapel Hill.Mouse Strains and Production of Bone Marrow-Derived MacrophagesWild-type, gp91phox-/-, and Inos-/- mice (all on the C57/B6 genetic background) were originally obtained from Jackson Laboratories and maintained in specific-pathogen-free conditions in Department of Lab and Animal Medicine facilities at UNC, Chapel Hill. All animal protocols were approved by the UNC-Chapel Hill Institutional Animal Care and Use Committee. Bone marrow derived macrophages (BMDMs) were obtained similar to methods described previously[27]. Briefly, bone marrow was harvested from femurs and tibias of mice by flushing marrow cavities with sterile RPMI through a 26G needle and red cells lysed with 0.8 ammonium chloride for 5 minutes. After washing twice with RPMI containing 10 FBS, 2.5 x 107 cells/ plate were added to 25cm petri dishes in 50mL RPMI/10 FBS/100U/mL penicillin/ 1000 g/ mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media. Three days later, 10mL of RPMI/10 FBS/100U/mL penicillin/ 1000 g/mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media was added to each plate. On day 6, adherent cells (BMDMs) were removed with TrypLE-Express (Invitrogen), counted, and plated into experimental wells.Gentamicin Protection AssaysIntra-macrophage bacterial survival assays were performed as described previously[14,23]. Briefly, approximately 10 mid-log phase bacteria/cell were added to 5?.5 x 105 BMDMs/well in 12-well plates in a tot.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant GW 4064 site recalled asking herself, `How do I see my life now?’ She AZD3759 web turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor BLU-554 chemical information included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). order AG-221 Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.buy PD0325901 alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not BKT140 price prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue purchase GW9662 usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, HIV-1 integrase inhibitor 2 web distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)GS-5816 biological activity Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone site quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

He free radical chemistry of ROOH containing systems can proceed either

He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated Thonzonium (bromide) molecular weight thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this CPI-455 site section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDPristinamycin IA solubility REFLECTIONS for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of ARRY-334543 cost Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of CyaneinMedChemExpress Synergisidin states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming GW 4064MedChemExpress GW 4064 bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) UNC0642 supplier levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to PM01183 price elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be BQ-123MedChemExpress BQ-123 provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the Procyanidin B1 clinical trials occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of S28463 msds midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is Pamapimod web possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the HS-173 chemical information stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, Peretinoin web because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Axonomy of learning aims, avoids assessment that rests on low ability.

Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require CBR-5884 web further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear obje