Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant Larotrectinib custom synthesis literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for Torin 1 biological activity exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a get Ciclosporin polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera PP58 dose species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.

Situation, most likely increasing morbidity, mortality and the cost of RRT

Situation, most likely increasing morbidity, mortality and the cost of RRT [21,30?1]. To our knowledge, this is the first evaluation of type of referral, dialysis start and modality choice on RRT described in Eastern Europe. Over the past several years, interest has evolved in evaluating the timing of nephrology referral in the predialytic stage of CKD as an important variable related to prognosis. Late referral to predialysis care and its quality may influence the selection of dialysis modality as well as the timing and planning of dialysis start [19,23,30?4]. The definition of the time TAK-385 site factor “late” is somewhat arbitrary and varies in the literature, ranging from less than 1 month to less than 6 months follow-up before RRT is started. Early referral to ICS was defined as at least a 3-month follow-up within the clinics’ care before starting RRT. However, at least one year is usually required to educate and optimize the preparation for RRT [13,32?4]. There are wide differences between different centers and countries in late referrals [35?6]. In Spain, Italy and France, data show that 20?5 of patients experienced late referrals, while higher figures are reported for other countries [36?42]. The relatively low involvement of nephrologists since initiation of CKD follow-up (48 ) compared with other series [23] may partially explain the high level of late referral. Late referral may deprive the patient from treatment to prevent or delay CKD progression and access to kidney transplantation, and inevitably lowers the possibility of receiving education, as well as choice options [11,32,43]. Numerous factors may be involved in a NP start, although some are unpredictable and others unacceptable/undesirable: asymptomatic renal disease (unpredictable), inadequate diagnosis or treatment of CKD (unacceptable), unexpected rapid deterioration of renal function, socio-economic reasons, patients reluctant to initiate dialysis or whose physicians underestimate the potential benefits of dialysis, long waiting lists to attend a predialysis care unit (unacceptable), waiting list for performing RP54476 chemical information Vascular access (unacceptable or undesirable) and others [23,41?4]. To our knowledge only one earlier study has covered the real reasons behind anPLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,8 /Referral, Modality and Dialysis Start in an International SettingTable 5. Clinical characteristics according to initial RRT modality. Population n Group: n ( ) ER+P ER+NP LR+P LR+NP Gender, Male, n ( ) Age at dialysis start < 35 years, n ( ) 35?0 years, n ( ) 51?5 years, n ( ) 66?5 years, n ( ) > 75 years, n ( ) Cause of ESRD Diabetes mellitus, n ( ) Glomerular, n ( ) Inherited, n ( ) Unknown, n ( ) Others, n ( ) Tubulo-interstitial, n ( ) Vascular, n ( ) Followed at initiation of CKD care by Nephrologist, n ( ) Time since initiation of CKD care to dialysis start (m.) Patient followed in predialysis (GFR<30 ml/min), n ( ) Patient followed by specialized predialysis staff, n ( ) Patient educated in modalities, n ( ) 162 (30) 64 (12) 26 (4) 52 (9) 56 (10) 62 (11) 125 (23) 264 (48) 12.3 (0.3?5) 332 (60) 160 (29) 436 (80) 143 (29) 52 (11) 21 (4) 49 (10) 51 (10) 57 (12) 115 (24) 230 (47) 12.8 (0.26?8) 288 (59) 145 (30) 382 (78) 19 (32) 12 (20) 5 (8) 3 (5) 5 (8) 5 (8) 10 (17) 34 (58) 10.0 (0.3?9) 44 (75) 15 (25) 54 (92) 0.02 0.54 0.02 0.13 0.45 0.18 21 (4) 66 (12) 186 (34) 127 (23) 147 (27) 16 (4) 48 (10) 166 (34) 119 (24) 139 (28) 5 (8) 18 (30) 20 (34) 8 (14) 8 (14) <0.001 16.Situation, most likely increasing morbidity, mortality and the cost of RRT [21,30?1]. To our knowledge, this is the first evaluation of type of referral, dialysis start and modality choice on RRT described in Eastern Europe. Over the past several years, interest has evolved in evaluating the timing of nephrology referral in the predialytic stage of CKD as an important variable related to prognosis. Late referral to predialysis care and its quality may influence the selection of dialysis modality as well as the timing and planning of dialysis start [19,23,30?4]. The definition of the time factor "late" is somewhat arbitrary and varies in the literature, ranging from less than 1 month to less than 6 months follow-up before RRT is started. Early referral to ICS was defined as at least a 3-month follow-up within the clinics' care before starting RRT. However, at least one year is usually required to educate and optimize the preparation for RRT [13,32?4]. There are wide differences between different centers and countries in late referrals [35?6]. In Spain, Italy and France, data show that 20?5 of patients experienced late referrals, while higher figures are reported for other countries [36?42]. The relatively low involvement of nephrologists since initiation of CKD follow-up (48 ) compared with other series [23] may partially explain the high level of late referral. Late referral may deprive the patient from treatment to prevent or delay CKD progression and access to kidney transplantation, and inevitably lowers the possibility of receiving education, as well as choice options [11,32,43]. Numerous factors may be involved in a NP start, although some are unpredictable and others unacceptable/undesirable: asymptomatic renal disease (unpredictable), inadequate diagnosis or treatment of CKD (unacceptable), unexpected rapid deterioration of renal function, socio-economic reasons, patients reluctant to initiate dialysis or whose physicians underestimate the potential benefits of dialysis, long waiting lists to attend a predialysis care unit (unacceptable), waiting list for performing vascular access (unacceptable or undesirable) and others [23,41?4]. To our knowledge only one earlier study has covered the real reasons behind anPLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,8 /Referral, Modality and Dialysis Start in an International SettingTable 5. Clinical characteristics according to initial RRT modality. Population n Group: n ( ) ER+P ER+NP LR+P LR+NP Gender, Male, n ( ) Age at dialysis start < 35 years, n ( ) 35?0 years, n ( ) 51?5 years, n ( ) 66?5 years, n ( ) > 75 years, n ( ) Cause of ESRD Diabetes mellitus, n ( ) Glomerular, n ( ) Inherited, n ( ) Unknown, n ( ) Others, n ( ) Tubulo-interstitial, n ( ) Vascular, n ( ) Followed at initiation of CKD care by Nephrologist, n ( ) Time since initiation of CKD care to dialysis start (m.) Patient followed in predialysis (GFR<30 ml/min), n ( ) Patient followed by specialized predialysis staff, n ( ) Patient educated in modalities, n ( ) 162 (30) 64 (12) 26 (4) 52 (9) 56 (10) 62 (11) 125 (23) 264 (48) 12.3 (0.3?5) 332 (60) 160 (29) 436 (80) 143 (29) 52 (11) 21 (4) 49 (10) 51 (10) 57 (12) 115 (24) 230 (47) 12.8 (0.26?8) 288 (59) 145 (30) 382 (78) 19 (32) 12 (20) 5 (8) 3 (5) 5 (8) 5 (8) 10 (17) 34 (58) 10.0 (0.3?9) 44 (75) 15 (25) 54 (92) 0.02 0.54 0.02 0.13 0.45 0.18 21 (4) 66 (12) 186 (34) 127 (23) 147 (27) 16 (4) 48 (10) 166 (34) 119 (24) 139 (28) 5 (8) 18 (30) 20 (34) 8 (14) 8 (14) <0.001 16.

Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines

Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines, and Culture ConditionsThe non-pathogenic murine E. coli strain NC101 was isolated as described previously[24]. E. coli strain O157:H7 was a kind gift from Dr. Ann Matthysse at UNC, Chapel Hill. E. coli were grown in Luria-Burtani (LB) broth at 37 with shaking at 250 rpm. The J774 murine macrophage and L929 fibroblast cell lines were originally obtained from ATCC (Manassas, VA) and cultured in RPMI ICG-001 supplement containing 10 fetal bovine serum (FBS), 100U/mL penicillin, 1000 g/mL streptomycin, and 10mM glutamine in 37 humidified incubators with 5 CO2. Conditioned media from L929 cells was used as a source of macrophage colony stimulating factor (M-CSF) for the production of bone marrow-derived macrophages (BMDMs) and was made as described previously[25]. The mutant E. coli NC101 strain lacking ibpA and ibpB (NC101ibpAB) that was used in this study had been generated previously using the -red recombinase method[23,26]. We used identical methods to create a mutant E. coli O157:H7 strain that lacks ibpA and ibpB (O157: H7ibpAB). However, since the pCP20 plasmid encoding Flp recombinase failed to induce recombination at the FRT sites in E. coli O157:H7, we used strains of NC101ibpAB and O157: H7ibpAB that still contained the kanamycin resistance gene. Mutant E. coli NC101 lacking oxyS (NC101oxyS) was also generated using the -red recombinase method. Primers 5’GCATAGCAACGAACGATTATCCCTATCAAGCATTCTGACTGTGTAGGCTGGAGCTGCTTC and 5′ ACCGTTACTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATCATATGAATATCCTCCTTAGTTCC were used to amplify the kanamycin resistance cassette from pKD4. Transformation and site-specific recombination of the PCR product into the oxyS locus on the E. coli NC101 chromosome followed by excision of the kanamycin resistance gene using pCP20 was performed as previously described[23,26]. Recombinant bacterial cell lines were generated in accordance with procedures outlined by the Environmental Health and Safety Department at University of North Carolina at Chapel Hill.Mouse Strains and Production of Bone Marrow-Derived MacrophagesWild-type, gp91phox-/-, and Inos-/- mice (all on the C57/B6 genetic background) were originally obtained from Jackson Laboratories and maintained in specific-pathogen-free conditions in Department of Lab and Animal Medicine facilities at UNC, Chapel Hill. All animal protocols were JNJ-26481585 site approved by the UNC-Chapel Hill Institutional Animal Care and Use Committee. Bone marrow derived macrophages (BMDMs) were obtained similar to methods described previously[27]. Briefly, bone marrow was harvested from femurs and tibias of mice by flushing marrow cavities with sterile RPMI through a 26G needle and red cells lysed with 0.8 ammonium chloride for 5 minutes. After washing twice with RPMI containing 10 FBS, 2.5 x 107 cells/ plate were added to 25cm petri dishes in 50mL RPMI/10 FBS/100U/mL penicillin/ 1000 g/ mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media. Three days later, 10mL of RPMI/10 FBS/100U/mL penicillin/ 1000 g/mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media was added to each plate. On day 6, adherent cells (BMDMs) were removed with TrypLE-Express (Invitrogen), counted, and plated into experimental wells.Gentamicin Protection AssaysIntra-macrophage bacterial survival assays were performed as described previously[14,23]. Briefly, approximately 10 mid-log phase bacteria/cell were added to 5?.5 x 105 BMDMs/well in 12-well plates in a tot.Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines, and Culture ConditionsThe non-pathogenic murine E. coli strain NC101 was isolated as described previously[24]. E. coli strain O157:H7 was a kind gift from Dr. Ann Matthysse at UNC, Chapel Hill. E. coli were grown in Luria-Burtani (LB) broth at 37 with shaking at 250 rpm. The J774 murine macrophage and L929 fibroblast cell lines were originally obtained from ATCC (Manassas, VA) and cultured in RPMI containing 10 fetal bovine serum (FBS), 100U/mL penicillin, 1000 g/mL streptomycin, and 10mM glutamine in 37 humidified incubators with 5 CO2. Conditioned media from L929 cells was used as a source of macrophage colony stimulating factor (M-CSF) for the production of bone marrow-derived macrophages (BMDMs) and was made as described previously[25]. The mutant E. coli NC101 strain lacking ibpA and ibpB (NC101ibpAB) that was used in this study had been generated previously using the -red recombinase method[23,26]. We used identical methods to create a mutant E. coli O157:H7 strain that lacks ibpA and ibpB (O157: H7ibpAB). However, since the pCP20 plasmid encoding Flp recombinase failed to induce recombination at the FRT sites in E. coli O157:H7, we used strains of NC101ibpAB and O157: H7ibpAB that still contained the kanamycin resistance gene. Mutant E. coli NC101 lacking oxyS (NC101oxyS) was also generated using the -red recombinase method. Primers 5’GCATAGCAACGAACGATTATCCCTATCAAGCATTCTGACTGTGTAGGCTGGAGCTGCTTC and 5′ ACCGTTACTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATCATATGAATATCCTCCTTAGTTCC were used to amplify the kanamycin resistance cassette from pKD4. Transformation and site-specific recombination of the PCR product into the oxyS locus on the E. coli NC101 chromosome followed by excision of the kanamycin resistance gene using pCP20 was performed as previously described[23,26]. Recombinant bacterial cell lines were generated in accordance with procedures outlined by the Environmental Health and Safety Department at University of North Carolina at Chapel Hill.Mouse Strains and Production of Bone Marrow-Derived MacrophagesWild-type, gp91phox-/-, and Inos-/- mice (all on the C57/B6 genetic background) were originally obtained from Jackson Laboratories and maintained in specific-pathogen-free conditions in Department of Lab and Animal Medicine facilities at UNC, Chapel Hill. All animal protocols were approved by the UNC-Chapel Hill Institutional Animal Care and Use Committee. Bone marrow derived macrophages (BMDMs) were obtained similar to methods described previously[27]. Briefly, bone marrow was harvested from femurs and tibias of mice by flushing marrow cavities with sterile RPMI through a 26G needle and red cells lysed with 0.8 ammonium chloride for 5 minutes. After washing twice with RPMI containing 10 FBS, 2.5 x 107 cells/ plate were added to 25cm petri dishes in 50mL RPMI/10 FBS/100U/mL penicillin/ 1000 g/ mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media. Three days later, 10mL of RPMI/10 FBS/100U/mL penicillin/ 1000 g/mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media was added to each plate. On day 6, adherent cells (BMDMs) were removed with TrypLE-Express (Invitrogen), counted, and plated into experimental wells.Gentamicin Protection AssaysIntra-macrophage bacterial survival assays were performed as described previously[14,23]. Briefly, approximately 10 mid-log phase bacteria/cell were added to 5?.5 x 105 BMDMs/well in 12-well plates in a tot.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant GW 4064 site recalled asking herself, `How do I see my life now?’ She AZD3759 web turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor BLU-554 chemical information included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). order AG-221 Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.buy PD0325901 alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not BKT140 price prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue purchase GW9662 usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, HIV-1 integrase inhibitor 2 web distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)GS-5816 biological activity Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone site quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

He free radical chemistry of ROOH containing systems can proceed either

He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated Thonzonium (bromide) molecular weight thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this CPI-455 site section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDPristinamycin IA solubility REFLECTIONS for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of ARRY-334543 cost Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of CyaneinMedChemExpress Synergisidin states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming GW 4064MedChemExpress GW 4064 bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) UNC0642 supplier levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to PM01183 price elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be BQ-123MedChemExpress BQ-123 provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the Procyanidin B1 clinical trials occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of S28463 msds midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is Pamapimod web possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the HS-173 chemical information stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, Peretinoin web because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Axonomy of learning aims, avoids assessment that rests on low ability.

Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require CBR-5884 web further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching CBR-5884 solubility activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis Vesatolimod biological activity catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information PD98059 structure provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Responses during feedback presentation. More importantly, we were interested in theinfluence

Responses during feedback presentation. More importantly, we were interested in theinfluence of social `context’ on ��-AmanitinMedChemExpress ��-Amanitin decisions and reward processes during risk taking, not the influence of feedback per se.Resistance to peer influenceParticipants also completed the resistance to peer influence (RPI) scale (Steinberg and Monahan, 2007). This questionnaire consists of ten pairs of opposing statements; e.g. `Some people go along with their friends just to keep their friends happy BUT other people refuse to go along with what their friends want to do, even though they know it will make their friends unhappy’. Participants were instructed to choose one statement and to report whether the chosen statement was `really true’ or `sort of true’ for them. Item scores ranged from 1 to 4 and the average across all ten items provides an index of RPI score, with higher scores indicating more self-reported resistance to peer influence. RPI scores for the 11-year olds (n ?23) ranged from 2.3 to 3.6 (M ?3.0 6 0.32), for the 12-year olds (n ?19) scores ranged from 1.8 to 3.8 (M ?3.1 6 0.45), and for the 13-year olds (n ?16) scores ranged from 2.2 to 3.8 (M ?2.9 6 0.45). There were no differences between age groups, F(2, 55) ?0.38, P ?0.69. Furthermore, RPI score did not correlate with any of the other developmental measures (Table 1), indicating that individual differences in resistance to peer influence did not correspond with differences in pubertal maturation.fMRI analysesSee Supplementary Materials for a detailed description of the image acquisition and preprocessing steps. Statistical analyses were performed on individual subjects’ data using the general linear model (GLM) in SPM8 (http://www.fil.ion.ucl.ac.uk). Trials were NVP-AUY922MedChemExpress VER-52296 modeled as separate zero-duration events starting at the onset of stimulus presentation. Note that while each trial consisted of a stimulus, anticipation, and outcome phase, these phases were not modeled separately due to the absence of jittered periods in between the different phases within each trial. Feedback phases were also modeled as zero-duration events starting at the onset of feedback presentation. Transition phases were modeled as 12-s events starting at the onset of the transition screen presentation. Here, we report the results of analyses collapsed across the different trial types (LR-1pt, LR3pts, HR-1pt, HR-3pts). We created two separate subject-specific design matrices to look at risk taking (choice model) and reward processing (outcome model), separately for the social rank and monetary feedback conditions. The choice model included four regressors ofTable 1. Correlations between the developmental measures, self-reported resistance to peer influence, and the relative measures of risk taking and RT (in percentages) Developmental measures Age RPI score (n ?58) r ??.03 P ?0.85 (n ?58) R ?0.01 P ?0.92 r ??.19 P ?0.15 PDS (n ?58) r ??.02 p ?0.87 (n ?58) r ?0.07 P ?0.62 r ?.03 P ?0.85 Testosterone (n ?57) r ??.02 P ?0.88 (n ?57) r ??.03 P ?0.84 r ?.14 P ?0.29 Estradiol (n ?56) r ?0.15 P ?0.29 (n ?56) r ?0.11 P ?0.43 r ??.01 P ?0.94 BMI (n ?56) r ??.11 P ?0.43 (n ?56) r ?0.12 P ?0.38 r ?0.12 P ?0.Risk taking (relative )RT (relative )RPI, resistance to peer influence; RT, response time; PDS, pubertal development stage; BMI, body-mass index.|Social Cognitive and Affective Neuroscience, 2017, Vol. 12, No.interest that modeled the trials based on the choices participants made, separately for each feedback type: Social Play, M.Responses during feedback presentation. More importantly, we were interested in theinfluence of social `context’ on decisions and reward processes during risk taking, not the influence of feedback per se.Resistance to peer influenceParticipants also completed the resistance to peer influence (RPI) scale (Steinberg and Monahan, 2007). This questionnaire consists of ten pairs of opposing statements; e.g. `Some people go along with their friends just to keep their friends happy BUT other people refuse to go along with what their friends want to do, even though they know it will make their friends unhappy’. Participants were instructed to choose one statement and to report whether the chosen statement was `really true’ or `sort of true’ for them. Item scores ranged from 1 to 4 and the average across all ten items provides an index of RPI score, with higher scores indicating more self-reported resistance to peer influence. RPI scores for the 11-year olds (n ?23) ranged from 2.3 to 3.6 (M ?3.0 6 0.32), for the 12-year olds (n ?19) scores ranged from 1.8 to 3.8 (M ?3.1 6 0.45), and for the 13-year olds (n ?16) scores ranged from 2.2 to 3.8 (M ?2.9 6 0.45). There were no differences between age groups, F(2, 55) ?0.38, P ?0.69. Furthermore, RPI score did not correlate with any of the other developmental measures (Table 1), indicating that individual differences in resistance to peer influence did not correspond with differences in pubertal maturation.fMRI analysesSee Supplementary Materials for a detailed description of the image acquisition and preprocessing steps. Statistical analyses were performed on individual subjects’ data using the general linear model (GLM) in SPM8 (http://www.fil.ion.ucl.ac.uk). Trials were modeled as separate zero-duration events starting at the onset of stimulus presentation. Note that while each trial consisted of a stimulus, anticipation, and outcome phase, these phases were not modeled separately due to the absence of jittered periods in between the different phases within each trial. Feedback phases were also modeled as zero-duration events starting at the onset of feedback presentation. Transition phases were modeled as 12-s events starting at the onset of the transition screen presentation. Here, we report the results of analyses collapsed across the different trial types (LR-1pt, LR3pts, HR-1pt, HR-3pts). We created two separate subject-specific design matrices to look at risk taking (choice model) and reward processing (outcome model), separately for the social rank and monetary feedback conditions. The choice model included four regressors ofTable 1. Correlations between the developmental measures, self-reported resistance to peer influence, and the relative measures of risk taking and RT (in percentages) Developmental measures Age RPI score (n ?58) r ??.03 P ?0.85 (n ?58) R ?0.01 P ?0.92 r ??.19 P ?0.15 PDS (n ?58) r ??.02 p ?0.87 (n ?58) r ?0.07 P ?0.62 r ?.03 P ?0.85 Testosterone (n ?57) r ??.02 P ?0.88 (n ?57) r ??.03 P ?0.84 r ?.14 P ?0.29 Estradiol (n ?56) r ?0.15 P ?0.29 (n ?56) r ?0.11 P ?0.43 r ??.01 P ?0.94 BMI (n ?56) r ??.11 P ?0.43 (n ?56) r ?0.12 P ?0.38 r ?0.12 P ?0.Risk taking (relative )RT (relative )RPI, resistance to peer influence; RT, response time; PDS, pubertal development stage; BMI, body-mass index.|Social Cognitive and Affective Neuroscience, 2017, Vol. 12, No.interest that modeled the trials based on the choices participants made, separately for each feedback type: Social Play, M.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled SB 202190 site asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan CEP-37440 cost Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

7 (0?.87) 0.11 (0?.30) 1.47 (0?.86) 0.26 (0?.10)trnH-psbA Yes 100 100 33 (114) 8 579 85 94 41 (1?6) 6.96 (0?4.12) 0. 09 (0?.84) 2.44 (0?.05) 0.15 (0?.84) 1.04 (0?.26) 0.02 (0?.13)matK Yes 100 100 33 (114) 5 826 60 65 2 (6) 2.84 (0?.91) 0.04 (0?.34) 0.86 (0?.85) 0.06 (0?.34) 0.13 (0?.49)rbcL Yes 99.09 100 32 (118) 5 672 27 29 0 1.41 (0?.80) 0.02 (0?.11) 0.66 (0?.19) 0.03 (0?.11) 0.13 (0?.30) 0.01 (0?.10)33 (123) 1 299 98 104 26 (1?3) 15.09 (0?9.47) 0.15 (0?.51) 3.28 (0?.98) 0.15 (0?.51) 2.10 (0?.73) 0.13 (0?.41)The distance based on the

7 (0?.87) 0.11 (0?.30) 1.47 (0?.86) 0.26 (0?.10)trnH-psbA Yes 100 100 33 (114) 8 579 85 94 41 (1?6) 6.96 (0?4.12) 0. 09 (0?.84) 2.44 (0?.05) 0.15 (0?.84) 1.04 (0?.26) 0.02 (0?.13)matK Yes 100 100 33 (114) 5 826 60 65 2 (6) 2.84 (0?.91) 0.04 (0?.34) 0.86 (0?.85) 0.06 (0?.34) 0.13 (0?.49)rbcL Yes 99.09 100 32 (118) 5 672 27 29 0 1.41 (0?.80) 0.02 (0?.11) 0.66 (0?.19) 0.03 (0?.11) 0.13 (0?.30) 0.01 (0?.10)33 (123) 1 299 98 104 26 (1?3) 15.09 (0?9.47) 0.15 (0?.51) 3.28 (0?.98) 0.15 (0?.51) 2.10 (0?.73) 0.13 (0?.41)The purchase FT011 distance based on the data from Schisandraceae. The distance based on the data from Schisandra and Kadsura. The distance based on the data from Illicium.doi:10.1371/journal.pone.0125574.tDNA extraction, amplification and sequencingTotal genomic DNA was extracted from specimens by grinding silica-gel dried-leaf tissue in liquid nitrogen, and then using the CTAB procedure [68]. Total genomic DNA was dissolved in TE buffer (10 mM Tris Cl, pH 8.0, 1 mM EDTA) to a final concentration of 30?0 ng/L. Polymerase chain reaction (PCR) amplification of targeted DNA regions was performed using 2 aq PCR MasterMix (Biomed, Imatinib (Mesylate) site Beijing, China), which containing 0.05 u/L of Taq DNA Polymerase, 4 mM MgCl2, 0.4 mM of dNTP and reaction buffer. The PCR mix included 12.5 L 2 aq PCR MasterMix, 2 L each primer (5 M), 1? L template DNA and enough distilled deionized water to give a final volume of 25 L. The primer information and optimal PCR conditions are displayed in S2 Table [69?4]. PCR products were examined electrophorectically using 0.8 agarose gels. The PCR products were purified using BioMed multifunctional DNA fragment purification recovery kits (Beijing, China), and then were sequenced using the amplification primers. The bidirectional sequencing was completed using the ABI 3730 DNA Sequencer (Applied Biosystems, Carlsbad, California, USA).Sequence alignmentThe quality estimation and assembly for the newly generated sequences were performed with ContigExpress 6.0 (Invitrogen, Carlsbad, California, USA). All the newly acquired sequences were confirmed via BLASTn (http://blast.ncbi.nlm.nih.gov/Blast.cgi) against the online nucleotide database and further deposited in GenBank. The accession numbers of new sequences and published sequences included in this study are provided in S1 Table. The sequence alignment for each locus was initially performed by using MUSCLE [75], and then manually edited in GeneDoc 2.7.0 [76]. The number of indel events for each dataset was inferred by deletion/insertion polymorphisms (DIP) analysis in DnaSP v5 [77]. In the DIP analysis, indels of different lengths, even in the same position of the alignment, are treated as different events. Because ofPLOS ONE | DOI:10.1371/journal.pone.0125574 May 4,4 /DNA Barcoding for Schisandraceaethe high divergence of ITS sequences among different plant families, only the 5.8S rDNA from the outgroup species could be aligned with ingroup sequences. Since the trnH-psbA sequences of other family are too divergent to be aligned with the sequences of Schisandraceae, the trnHpsbA sequences of the outgroup species were not used in the analysis. In further analyses, both family-level and genus-level assessments of the discriminatory power for single regions and their combinations were included. For the genus-level assessment, Illicium and Schisandra/ Kadsura were analyzed independently, because Illicium is quite different from Schisandra and Kadsura according to species morphology [37?9] and s.7 (0?.87) 0.11 (0?.30) 1.47 (0?.86) 0.26 (0?.10)trnH-psbA Yes 100 100 33 (114) 8 579 85 94 41 (1?6) 6.96 (0?4.12) 0. 09 (0?.84) 2.44 (0?.05) 0.15 (0?.84) 1.04 (0?.26) 0.02 (0?.13)matK Yes 100 100 33 (114) 5 826 60 65 2 (6) 2.84 (0?.91) 0.04 (0?.34) 0.86 (0?.85) 0.06 (0?.34) 0.13 (0?.49)rbcL Yes 99.09 100 32 (118) 5 672 27 29 0 1.41 (0?.80) 0.02 (0?.11) 0.66 (0?.19) 0.03 (0?.11) 0.13 (0?.30) 0.01 (0?.10)33 (123) 1 299 98 104 26 (1?3) 15.09 (0?9.47) 0.15 (0?.51) 3.28 (0?.98) 0.15 (0?.51) 2.10 (0?.73) 0.13 (0?.41)The distance based on the data from Schisandraceae. The distance based on the data from Schisandra and Kadsura. The distance based on the data from Illicium.doi:10.1371/journal.pone.0125574.tDNA extraction, amplification and sequencingTotal genomic DNA was extracted from specimens by grinding silica-gel dried-leaf tissue in liquid nitrogen, and then using the CTAB procedure [68]. Total genomic DNA was dissolved in TE buffer (10 mM Tris Cl, pH 8.0, 1 mM EDTA) to a final concentration of 30?0 ng/L. Polymerase chain reaction (PCR) amplification of targeted DNA regions was performed using 2 aq PCR MasterMix (Biomed, Beijing, China), which containing 0.05 u/L of Taq DNA Polymerase, 4 mM MgCl2, 0.4 mM of dNTP and reaction buffer. The PCR mix included 12.5 L 2 aq PCR MasterMix, 2 L each primer (5 M), 1? L template DNA and enough distilled deionized water to give a final volume of 25 L. The primer information and optimal PCR conditions are displayed in S2 Table [69?4]. PCR products were examined electrophorectically using 0.8 agarose gels. The PCR products were purified using BioMed multifunctional DNA fragment purification recovery kits (Beijing, China), and then were sequenced using the amplification primers. The bidirectional sequencing was completed using the ABI 3730 DNA Sequencer (Applied Biosystems, Carlsbad, California, USA).Sequence alignmentThe quality estimation and assembly for the newly generated sequences were performed with ContigExpress 6.0 (Invitrogen, Carlsbad, California, USA). All the newly acquired sequences were confirmed via BLASTn (http://blast.ncbi.nlm.nih.gov/Blast.cgi) against the online nucleotide database and further deposited in GenBank. The accession numbers of new sequences and published sequences included in this study are provided in S1 Table. The sequence alignment for each locus was initially performed by using MUSCLE [75], and then manually edited in GeneDoc 2.7.0 [76]. The number of indel events for each dataset was inferred by deletion/insertion polymorphisms (DIP) analysis in DnaSP v5 [77]. In the DIP analysis, indels of different lengths, even in the same position of the alignment, are treated as different events. Because ofPLOS ONE | DOI:10.1371/journal.pone.0125574 May 4,4 /DNA Barcoding for Schisandraceaethe high divergence of ITS sequences among different plant families, only the 5.8S rDNA from the outgroup species could be aligned with ingroup sequences. Since the trnH-psbA sequences of other family are too divergent to be aligned with the sequences of Schisandraceae, the trnHpsbA sequences of the outgroup species were not used in the analysis. In further analyses, both family-level and genus-level assessments of the discriminatory power for single regions and their combinations were included. For the genus-level assessment, Illicium and Schisandra/ Kadsura were analyzed independently, because Illicium is quite different from Schisandra and Kadsura according to species morphology [37?9] and s.

Proved the relationships between Chinese patients and physicians [54?6]. Lastly, implementing a

Proved the relationships between Chinese patients and physicians [54?6]. Lastly, implementing a primary care model that allows patients the opportunity to develop a long-term relationship with a physician could be important. This model is already being piloted at sites in Shenzhen, Beijing, and Shanghai [53,57,58]. Expanding this model to Guangzhou in conjunction with interpreter services and outreach to African community leaders might help to promote trust in physicians among African migrants. The African migrant population in Guangzhou is diverse, and it is difficult to generate findings that are generalizable for this population. We sought to capture this diversity in our study through purposive sampling. Due to the sensitivity of the topic, we did not specifically ask participants about their visa status, and discussion of visas and immigration concerns arose infrequently in our interviews. Two participants, however, mentioned that they did not have valid visas. Migrants without current documentation may have been less likely to participate in our study, a challenge that other researchers studying the African population in Guangzhou have reported [22]. Additionally, we did not recruit African migrants from Francophone or Lusophone countries who were unable to speak English. These are likely to be some of the most marginalized migrants, and research on their health care experiences in China is needed. As China pursues ongoing national health reform [59], the experience of African migrant patients needs to be considered when designing interventions to improve the quality of patient-physician relationships. Additional research and pilot studies are needed to better understand the potential for measures such as professional interpreter services, payment reform, and primary care models to improve African migrants’ trust in Chinese physicians.Supporting InformationS1 Table. Demographic characteristics of African migrants interviewed. (PDF)PLOS ONE | DOI:10.1371/journal.pone.0123255 May 12,10 /African Migrant Patients’ Trust in Chinese PhysiciansS2 Table. Quotes supporting study themes. (PDF)AcknowledgmentsWe thank Margaret Lee for her comments on a previous version of this manuscript. We also thank Yu Cheng, Xiang Zou, Jiazhi Zeng, and Yong Xu for their contributions to the research.Author ContributionsConceived and designed the experiments: MMM LL JDT. Performed the experiments: MMM LS XZ. Analyzed the data: MMM LS XZ LL JDT. Contributed reagents/materials/analysis tools: JDT. Wrote the paper: MMM LS XZ LL JDT.
ResourceMultiomic Analysis of the UV-Induced DNA Damage ResponseGraphical Abstract AuthorsStefan Boeing, Laura Williamson, Vesela Encheva, …, Michael Howell, Ambrosius P. Snijders, Jesper Q. [email protected] BriefBoeing et al. investigate the UV-induced DNA damage response by Quinoline-Val-Asp-Difluorophenoxymethylketone site combining a range of proteomic and genomic screens. A function in this response for the melanoma driver STK19 as well as a number of other factors are uncovered.HighlightsdA multiomic PX-478MedChemExpress PX-478 screening approach examines the UV-induced DNA damage response Multiple factors are connected to the transcription-related DNA damage response Melanoma gene STK19 is required for a normal DNA damage responseddBoeing et al., 2016, Cell Reports 15, 1597?610 May 17, 2016 ?2016 The Author(s) http://dx.doi.org/10.1016/j.celrep.2016.04.Cell ReportsResourceMultiomic Analysis of the UV-Induced DNA Damage ResponseStefan Boeing,1,5 Laura Williamson,1.Proved the relationships between Chinese patients and physicians [54?6]. Lastly, implementing a primary care model that allows patients the opportunity to develop a long-term relationship with a physician could be important. This model is already being piloted at sites in Shenzhen, Beijing, and Shanghai [53,57,58]. Expanding this model to Guangzhou in conjunction with interpreter services and outreach to African community leaders might help to promote trust in physicians among African migrants. The African migrant population in Guangzhou is diverse, and it is difficult to generate findings that are generalizable for this population. We sought to capture this diversity in our study through purposive sampling. Due to the sensitivity of the topic, we did not specifically ask participants about their visa status, and discussion of visas and immigration concerns arose infrequently in our interviews. Two participants, however, mentioned that they did not have valid visas. Migrants without current documentation may have been less likely to participate in our study, a challenge that other researchers studying the African population in Guangzhou have reported [22]. Additionally, we did not recruit African migrants from Francophone or Lusophone countries who were unable to speak English. These are likely to be some of the most marginalized migrants, and research on their health care experiences in China is needed. As China pursues ongoing national health reform [59], the experience of African migrant patients needs to be considered when designing interventions to improve the quality of patient-physician relationships. Additional research and pilot studies are needed to better understand the potential for measures such as professional interpreter services, payment reform, and primary care models to improve African migrants’ trust in Chinese physicians.Supporting InformationS1 Table. Demographic characteristics of African migrants interviewed. (PDF)PLOS ONE | DOI:10.1371/journal.pone.0123255 May 12,10 /African Migrant Patients’ Trust in Chinese PhysiciansS2 Table. Quotes supporting study themes. (PDF)AcknowledgmentsWe thank Margaret Lee for her comments on a previous version of this manuscript. We also thank Yu Cheng, Xiang Zou, Jiazhi Zeng, and Yong Xu for their contributions to the research.Author ContributionsConceived and designed the experiments: MMM LL JDT. Performed the experiments: MMM LS XZ. Analyzed the data: MMM LS XZ LL JDT. Contributed reagents/materials/analysis tools: JDT. Wrote the paper: MMM LS XZ LL JDT.
ResourceMultiomic Analysis of the UV-Induced DNA Damage ResponseGraphical Abstract AuthorsStefan Boeing, Laura Williamson, Vesela Encheva, …, Michael Howell, Ambrosius P. Snijders, Jesper Q. [email protected] BriefBoeing et al. investigate the UV-induced DNA damage response by combining a range of proteomic and genomic screens. A function in this response for the melanoma driver STK19 as well as a number of other factors are uncovered.HighlightsdA multiomic screening approach examines the UV-induced DNA damage response Multiple factors are connected to the transcription-related DNA damage response Melanoma gene STK19 is required for a normal DNA damage responseddBoeing et al., 2016, Cell Reports 15, 1597?610 May 17, 2016 ?2016 The Author(s) http://dx.doi.org/10.1016/j.celrep.2016.04.Cell ReportsResourceMultiomic Analysis of the UV-Induced DNA Damage ResponseStefan Boeing,1,5 Laura Williamson,1.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a MK-8742 manufacturer multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for ��-Amanitin site paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal MLN9708 biological activity hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. MS-275MedChemExpress Entinostat Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli PXD101 manufacturer strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when get Vorapaxar present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough MG-132 web TF14016 dose social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

Ilitate the work of JZ programme staff and foster the health

Ilitate the work of JZ programme staff and foster the health and safety of FSW. We describe each of these main activities and cross-cutting themes below. Core programmatic activities A welcoming clinic setting and high-quality clinical services–FSWs face the dual stigma of HIV/STI and sex work, creating barriers to seeking and receiving medical care. JZ provides a safe physical and social space for FSW to see doctors and share their lives. The JZ clinic and activity centre are located in a discrete, convenient area within the city. This centre was intentionally designed for comfort: a clean, warm environment, a reception desk at the entrance, plants and decorations, a television and two massage beds at the back of the first floor. On the second floor, an outside room is used as a waiting room. The walls are decorated with IEC materials and notes written by FSW with wishes and `words from the heart’. Practical tips for women are also posted, such as an example of counterfeit money (a common problem in China) with a description of how to identify it. A round table and drinking water are always set out for chatting. BMS-214662 web Separated from the waiting room, an inner room is outfitted with a clean bed and standard medical facilities for physical exams, STI testing and treatment. The clinic is reserved especially for FSW and is not open to the public. As Dr Z noted, this allows the clinic to offer a safe, confidential space ?a feature that was highly valued by the FSW we interviewed. FSWs come to the clinic through outreach contact and introduction by other FSW. Women were also mobilised to bring new FSW and their regular partners (boyfriends, regular male clients) for STI treatment. The welcoming environment and high quality of clinic service, as illustrated below, made JZ clinic well known via word of mouth among the local FSW community. In addition, to avoid being recognised as the `FSW clinic’, which might bring stigma upon clientele, Dr Z named the clinic the `JZ Love and Health Consultation Centre’. Within the welcoming clinic environment, JZ staff provides high-quality reproductive and gynaecological services including physical exams and blood testing for syphilis and HIV. When the JZ clinic first opened, services were provided free of charge. Later, a basic feefor-service plan (e.g. 3? USD/blood test for STI) was implemented in order to foster FSWs’ self-responsibility to care about their health and to support the financial sustainability of the project. Dr Z is a trained expert in STI and gynaecology. According to her, `you must know your own body well, rather than only focusing on getting the disease cured; one of our goals is to increase health awareness in everyday life’. As we observed, the exam process was usually accompanied by dialogue on how a woman may have gotten sick (e.g. partners, behaviours) and how to avoid getting sick in the future. Dr Z approached FSW as if they were friends or sisters when talking about their sexual relationships. The following passage describes a typical clinic scene based on our fieldwork observations:Glob Public Health. Author manuscript; available in PMC 2016 August 01.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptHuang et al.PageFSW usually came either with another female friend, or their boyfriends (occasionally with pimps) in late morning and early afternoon before their business Avermectin B1a price started. In a situation with boyfriends or pimps there (at clinic), the staff would avoid topic.Ilitate the work of JZ programme staff and foster the health and safety of FSW. We describe each of these main activities and cross-cutting themes below. Core programmatic activities A welcoming clinic setting and high-quality clinical services–FSWs face the dual stigma of HIV/STI and sex work, creating barriers to seeking and receiving medical care. JZ provides a safe physical and social space for FSW to see doctors and share their lives. The JZ clinic and activity centre are located in a discrete, convenient area within the city. This centre was intentionally designed for comfort: a clean, warm environment, a reception desk at the entrance, plants and decorations, a television and two massage beds at the back of the first floor. On the second floor, an outside room is used as a waiting room. The walls are decorated with IEC materials and notes written by FSW with wishes and `words from the heart’. Practical tips for women are also posted, such as an example of counterfeit money (a common problem in China) with a description of how to identify it. A round table and drinking water are always set out for chatting. Separated from the waiting room, an inner room is outfitted with a clean bed and standard medical facilities for physical exams, STI testing and treatment. The clinic is reserved especially for FSW and is not open to the public. As Dr Z noted, this allows the clinic to offer a safe, confidential space ?a feature that was highly valued by the FSW we interviewed. FSWs come to the clinic through outreach contact and introduction by other FSW. Women were also mobilised to bring new FSW and their regular partners (boyfriends, regular male clients) for STI treatment. The welcoming environment and high quality of clinic service, as illustrated below, made JZ clinic well known via word of mouth among the local FSW community. In addition, to avoid being recognised as the `FSW clinic’, which might bring stigma upon clientele, Dr Z named the clinic the `JZ Love and Health Consultation Centre’. Within the welcoming clinic environment, JZ staff provides high-quality reproductive and gynaecological services including physical exams and blood testing for syphilis and HIV. When the JZ clinic first opened, services were provided free of charge. Later, a basic feefor-service plan (e.g. 3? USD/blood test for STI) was implemented in order to foster FSWs’ self-responsibility to care about their health and to support the financial sustainability of the project. Dr Z is a trained expert in STI and gynaecology. According to her, `you must know your own body well, rather than only focusing on getting the disease cured; one of our goals is to increase health awareness in everyday life’. As we observed, the exam process was usually accompanied by dialogue on how a woman may have gotten sick (e.g. partners, behaviours) and how to avoid getting sick in the future. Dr Z approached FSW as if they were friends or sisters when talking about their sexual relationships. The following passage describes a typical clinic scene based on our fieldwork observations:Glob Public Health. Author manuscript; available in PMC 2016 August 01.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptHuang et al.PageFSW usually came either with another female friend, or their boyfriends (occasionally with pimps) in late morning and early afternoon before their business started. In a situation with boyfriends or pimps there (at clinic), the staff would avoid topic.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To H 4065 site prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when ML390 supplier describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior Sitravatinib site source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (Naramycin A chemical information undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be PP58MedChemExpress PP58 executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,JWH-133 price Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion GW 4064 msds section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve MK-1439 biological activity energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s 4-HydroxytamoxifenMedChemExpress trans-4-Hydroxytamoxifen thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory TAPI-2 web Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

Ount of data, say for two or three weeks, is needed

Ount of data, say for two or three weeks, is needed to give a good idea of the sentiment of a Twitter community, and if a drastic change in sentiment does occur within a community, this is a rare event and may indicate that something important has happened to or within the community.community sentiment (MC)1.2 1.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………0.8 0.6 0.4 0.2 0 0.community sentiment (SS) community sentiment (L)0.4 0.2 0 ?.2 ?.4 5.0 4.0 3.0 2.0 1.0Figure 12. The daily mean sentiment in community 2 (Indian politics) from 22 September 2014 to 1 March 2015. Five interesting events are identified.Looking at the daily PD168393 site average sentiment in each community, that is, looking at a higher resolution, more detail is evident. Figure 12 shows the daily mean sentiment in community 2 (Indian politics), also for the period 22 September 2014 to 1 March 2015. Large day-to-day variations can be seen, and we have noticed that often such abrupt changes can be traced to real events affecting the community. In figure 12, we have highlighted five dates where the sentiment measures show spikes or troughs. By examining the tweets sent on those dates we identified the significant event that drove the sentiment change:S 29 ep 2 S 01 06 ep 2 4 O 01 13 ct 2 4 O 01 20 ct 2 4 O 01 27 ct 2 4 O 0 03 ct 14 N 20 10 ov 14 N 20 17 ov 14 N 20 24 ov 14 N 201 o 4 1 v 20 D 14 e 8 c 20 D 1 15 ec 2 4 01 D 22 ec 2 4 D 01 29 ec 2 4 D 01 ec 4 5 20 Ja 1 12 n 2 4 Ja 01 19 n 2 5 Ja 01 26 n 2 5 Ja 015 2 n 20 Fe 1 5 9 b 20 Fe 1 16 b 2 5 F 01 23 eb 2 5 Fe 01 b 5 20– 24 September 2014: India’s Mars Orbiter Mission space probe entered orbit around Mars, and people celebrated. — 23 October 2014: the beginning of the Diwali festival. — 16 December 2014: gunmen affiliated with the Tehrik-i-Taliban conducted a terrorist attack in the northwestern Pakistani city of Peshawar. — 1 January 2014: New Year’s Day. — 7th January 2015: gunmen attacked the offices of the French satirical weekly newspaper Charlie Hebdo in Paris.5. An agent-based model of sentiments dynamics in communitiesIt has been discovered time after time that the collective behaviour of Torin 1 side effects populations of interacting individuals is difficult to understand, challenging to predict and sometimes even seemingly paradoxical. In order to be able to predict the likely evolution of sentiment within a community and to explore its dynamics under various change scenarios, such as the departure of particular users or the arrival of a new vocal user, we built an ABM of our Twitter communities. This includes modelling the sentiment of individuals in the network, and how sentiment spreads from one user to another. The agents in the model represent Twitter users, and they are arranged in a static undirected graph; only pairs of agents connected by an edge are able to exchange messages. The simulation proceeds in discrete time steps; the number of these steps per day is a parameter of the model. At each time step the following things happen: — Each agent performs an action which consists of sending a burst of messages to all/some/none of its neighbours, influenced by the agent’s current state. — Each agent evolves into a new state, influenced by the actions of other agents in this step, i.e. influenced by the messages it has received this step. Specifically, an action by an agent consists of: a subset of neighbours who will be messaged at this time step; for each neighbour messaged,.Ount of data, say for two or three weeks, is needed to give a good idea of the sentiment of a Twitter community, and if a drastic change in sentiment does occur within a community, this is a rare event and may indicate that something important has happened to or within the community.community sentiment (MC)1.2 1.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………0.8 0.6 0.4 0.2 0 0.community sentiment (SS) community sentiment (L)0.4 0.2 0 ?.2 ?.4 5.0 4.0 3.0 2.0 1.0Figure 12. The daily mean sentiment in community 2 (Indian politics) from 22 September 2014 to 1 March 2015. Five interesting events are identified.Looking at the daily average sentiment in each community, that is, looking at a higher resolution, more detail is evident. Figure 12 shows the daily mean sentiment in community 2 (Indian politics), also for the period 22 September 2014 to 1 March 2015. Large day-to-day variations can be seen, and we have noticed that often such abrupt changes can be traced to real events affecting the community. In figure 12, we have highlighted five dates where the sentiment measures show spikes or troughs. By examining the tweets sent on those dates we identified the significant event that drove the sentiment change:S 29 ep 2 S 01 06 ep 2 4 O 01 13 ct 2 4 O 01 20 ct 2 4 O 01 27 ct 2 4 O 0 03 ct 14 N 20 10 ov 14 N 20 17 ov 14 N 20 24 ov 14 N 201 o 4 1 v 20 D 14 e 8 c 20 D 1 15 ec 2 4 01 D 22 ec 2 4 D 01 29 ec 2 4 D 01 ec 4 5 20 Ja 1 12 n 2 4 Ja 01 19 n 2 5 Ja 01 26 n 2 5 Ja 015 2 n 20 Fe 1 5 9 b 20 Fe 1 16 b 2 5 F 01 23 eb 2 5 Fe 01 b 5 20– 24 September 2014: India’s Mars Orbiter Mission space probe entered orbit around Mars, and people celebrated. — 23 October 2014: the beginning of the Diwali festival. — 16 December 2014: gunmen affiliated with the Tehrik-i-Taliban conducted a terrorist attack in the northwestern Pakistani city of Peshawar. — 1 January 2014: New Year’s Day. — 7th January 2015: gunmen attacked the offices of the French satirical weekly newspaper Charlie Hebdo in Paris.5. An agent-based model of sentiments dynamics in communitiesIt has been discovered time after time that the collective behaviour of populations of interacting individuals is difficult to understand, challenging to predict and sometimes even seemingly paradoxical. In order to be able to predict the likely evolution of sentiment within a community and to explore its dynamics under various change scenarios, such as the departure of particular users or the arrival of a new vocal user, we built an ABM of our Twitter communities. This includes modelling the sentiment of individuals in the network, and how sentiment spreads from one user to another. The agents in the model represent Twitter users, and they are arranged in a static undirected graph; only pairs of agents connected by an edge are able to exchange messages. The simulation proceeds in discrete time steps; the number of these steps per day is a parameter of the model. At each time step the following things happen: — Each agent performs an action which consists of sending a burst of messages to all/some/none of its neighbours, influenced by the agent’s current state. — Each agent evolves into a new state, influenced by the actions of other agents in this step, i.e. influenced by the messages it has received this step. Specifically, an action by an agent consists of: a subset of neighbours who will be messaged at this time step; for each neighbour messaged,.

Results: main effectsTo test whether feedback type modulated activation in regions

Results: main effectsTo test whether feedback type modulated activation in regions associated with reward processing during risk taking, we examined individual differences in activation of NAc (based on Haber and Knutson, 2010) and mPFC (based on Op de Macks et al., in press). Results of the ROI analyses Win 63843 biological activity showed that, across participants, there was no main effect of feedback type on either NAc or mPFC activation (Supplementary Figure S1). To examine whether other brain regions showed a main effect of feedback type, we conducted whole-brain analyses for brain activation during risk taking and reward processing separately. Risk taking-related brain activation. Results of the whole-brain analysis across participants (n ?58) for the contrast of Social > Monetary Play revealed clusters of activation in bilateral anterior insula (AI), with the left peak at: x ??8, y ?17, z ?? (cluster-level FWE corrected P ?0.004), and the right peak at: x ?46, y ?22, z ?? (cluster-level FWE corrected P ?0.002) (Figure 4A). These results indicate that bilateral AI was more active during trials on which participants chose to play in the social rank feedback context compared to trials on which participants chose to play in the monetary feedback context. Further examination of the patterns of brain activation in bilateral AI showed that activation in this region was increased forPlay choices–regardless of whether they resulted in Gain or Loss–compared with Pass choices in the social rank feedback context [Gain > Pass: t(57) ?2.9, P ?0.005; Loss > Pass: t(57) ?2.5, P ?0.015], but not in the monetary feedback context (Gain > Pass: t(56) ?0.22, P ?0.83; Loss > Pass: t(56) ?0.78, p ?0.44) (Figure 5A). These findings indicate that bilateral AI distinguished between risky and safe choices when playing for rank, but not when playing for money. Additional clusters of activation were found in left fusiform (peak at: x ??0, y ??2, z ??4, cluster-level FWE corrected P < 0.001) and lingual gyrus (peak at: x ??2, y ??5, z ??, cluster-level FWE corrected P ?0.003). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Play, nor for the contrasts of Social > Monetary Pass and Monetary > Social Pass. Reward-related brain activation. Results of the whole-brain analysis across participants for the contrast of Social > Monetary Gain revealed clusters of activation in left fusiform gyrus (peak at: x ??2, y ??9, z ??1, cluster-level FWE corrected P < .001), and in right AI (peak at: x ?36, y ?16, z ?-6, cluster-level FWE corrected P < 0.001) (Figure 4B). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Gain, nor for the contrasts of Social > Monetary Loss and Monetary > Social Loss. However, at a lowered threshold of P < 0.001 uncorrected with k ! 10 voxels, we found a cluster of activation in left AI (peak at: x ??8, y ?17, z ??) for Social > Monetary Loss (Figure 4C). These results indicate that AI (and fusiform gyrus) was more strongly activated when playing for rank resulted in gains than when playing for money resulted in gains. See Supplementary Figure S2 for the BOLD time-courses of the left and right AI, plotted separately for gain, loss, and pass trials in both the social rank and monetary feedback conditions.Individual differences in AI activationTo test whether Ensartinib biological activity pubertal ho.Results: main effectsTo test whether feedback type modulated activation in regions associated with reward processing during risk taking, we examined individual differences in activation of NAc (based on Haber and Knutson, 2010) and mPFC (based on Op de Macks et al., in press). Results of the ROI analyses showed that, across participants, there was no main effect of feedback type on either NAc or mPFC activation (Supplementary Figure S1). To examine whether other brain regions showed a main effect of feedback type, we conducted whole-brain analyses for brain activation during risk taking and reward processing separately. Risk taking-related brain activation. Results of the whole-brain analysis across participants (n ?58) for the contrast of Social > Monetary Play revealed clusters of activation in bilateral anterior insula (AI), with the left peak at: x ??8, y ?17, z ?? (cluster-level FWE corrected P ?0.004), and the right peak at: x ?46, y ?22, z ?? (cluster-level FWE corrected P ?0.002) (Figure 4A). These results indicate that bilateral AI was more active during trials on which participants chose to play in the social rank feedback context compared to trials on which participants chose to play in the monetary feedback context. Further examination of the patterns of brain activation in bilateral AI showed that activation in this region was increased forPlay choices–regardless of whether they resulted in Gain or Loss–compared with Pass choices in the social rank feedback context [Gain > Pass: t(57) ?2.9, P ?0.005; Loss > Pass: t(57) ?2.5, P ?0.015], but not in the monetary feedback context (Gain > Pass: t(56) ?0.22, P ?0.83; Loss > Pass: t(56) ?0.78, p ?0.44) (Figure 5A). These findings indicate that bilateral AI distinguished between risky and safe choices when playing for rank, but not when playing for money. Additional clusters of activation were found in left fusiform (peak at: x ??0, y ??2, z ??4, cluster-level FWE corrected P < 0.001) and lingual gyrus (peak at: x ??2, y ??5, z ??, cluster-level FWE corrected P ?0.003). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Play, nor for the contrasts of Social > Monetary Pass and Monetary > Social Pass. Reward-related brain activation. Results of the whole-brain analysis across participants for the contrast of Social > Monetary Gain revealed clusters of activation in left fusiform gyrus (peak at: x ??2, y ??9, z ??1, cluster-level FWE corrected P < .001), and in right AI (peak at: x ?36, y ?16, z ?-6, cluster-level FWE corrected P < 0.001) (Figure 4B). No regions of activation survived correction for multiple comparisons (at either peak- or cluster-level) for the opposite contrast of Monetary > Social Gain, nor for the contrasts of Social > Monetary Loss and Monetary > Social Loss. However, at a lowered threshold of P < 0.001 uncorrected with k ! 10 voxels, we found a cluster of activation in left AI (peak at: x ??8, y ?17, z ??) for Social > Monetary Loss (Figure 4C). These results indicate that AI (and fusiform gyrus) was more strongly activated when playing for rank resulted in gains than when playing for money resulted in gains. See Supplementary Figure S2 for the BOLD time-courses of the left and right AI, plotted separately for gain, loss, and pass trials in both the social rank and monetary feedback conditions.Individual differences in AI activationTo test whether pubertal ho.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later Losmapimod site adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough Losmapimod custom synthesis social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming get Enzastaurin clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC HMPL-013 structure materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misOlumacostat glasaretil chemical information represent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature BUdR web search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

He free radical chemistry of ROOH containing systems can proceed either

He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.get AZD-8835 Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard T0901317 cost conditions both in the gas phase and in aqueous s.He free radical chemistry of ROOH containing systems can proceed either by O or O homolysis. Here we only discuss the chemistry of the O bond; the interested reader is pointed to a review of the radiation and photochemistry of peroxides, which discusses a variety of O bond homolysis reactions.230 PCET reactions of organic peroxyl radicals have almost always been understood as HAT reactions, especially the chain propagating stepChem Rev. Author manuscript; available in PMC 2011 December 8.Warren et al.Pagein autoxidation.17 This makes sense because of the strong ROO bonds, while PT-ET or ET-PT pathways are disfavored by the low basicity of ROO?and the moderate ROO?- potentials (Table 10). The most commonly employed organic hydroperoxide is tert-butyl hydroperoxide. The gas phase thermochemistry of organic peroxides has been widely discussed. Simmie et al.231 recently gave Hf?tBuOO? = -24.69 kcal mol-1, which, together with Hf?H? = 52.103 kcal mol-1 232 and Hf?tBuOOH) = -56.14 kcal mol-1 233, gives BDEg(tBuOOH) = 83.6 kcal mol-1.234 The pKas of several alkyl hydroperoxides and peracids have long been known,235 and pKa values for several peroxybenzoic acid have been reported.236 However, until recently, the reduction potentials of the corresponding peroxyl radicals have remained elusive. Das and co-workers indirectly measured the ROO?- couple for several peroxyl compounds in water (Table 10).237 Their value for E?tBuOO-/? is in good agreement with an earlier estimate made using kinetic and pKa data.238 In contrast, very little data exists on the redox potentials of percarboxylate anions. Peracids have gas phase BDFEs that are a little higher, and they are more acidic than the corresponding alkyl peroxides, which indicate that the RC(O)OO?- potentials are probably more oxidizing ( 1 V).239 Jonsson’s estimate of E?(CH3C(O)OO?-) = 1.14 V240 is in agreement with this estimate. Jonsson has also estimated thermochemical data for a variety of other peroxides but these need to be used with caution as they were extracted from electron transfer kinetic data240 and some of these values do not agree with those determined via more direct methods (e.g., Jonsson gives E?(Cl3COO?-) = 1.17 V while and Das reports E?Cl3COO?-) = 1.44 V237). 5.5 Simple Nitrogen Compounds: Dinitrogen to Ammonia, Amines, and Arylamines The previous sections all focused on reagents with reactive O bonds. With this section we shift to N bonds, and those below deal with S and C bonds. While the same principles apply, there are some important differences. N bonds are less acidic than comparable O bonds, and in general N-lone pairs are higher in energy so nitrogen compounds are more basic and more easily lose an electron to form the radical cation. Therefore, stepwise PCET reactions of amines typically involve aminium radical cations (R3N?), particularly for arylamines, while those of alcohols and phenols involve alkoxides and phenoxides. We start with the simple gas phase species from N2 to ammonia, then progress to alkyl and aryl amines, and finally to more complex aromatic heterocycles of biological interest. 5.5.1 Dinitrogen, Diazine, and Hydrazine–Dinitrogen (N2) is one of the most abundant compounds on earth, making it an almost unlimited feedstock for the production of reduced nitrogen species such as ammonia. The overall reduction of dinitrogen to ammonia by dihydrogen is thermodynamically favorable under standard conditions both in the gas phase and in aqueous s.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal Mdivi-1 dose hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics AZD1722 chemical information follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial Citarinostat price damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s Quinoline-Val-Asp-Difluorophenoxymethylketone site disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile I-BRD9 web phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor PP58 cancer Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a RG7800 manufacturer highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left AZD0156 biological activity column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in CP 472295 web cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a Talmapimod solubility coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic Necrosulfonamide supplement inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Stattic web Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on buy Pan-RAS-IN-1 increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is SC144 web linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the BQ-123 msds services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional BQ-123 side effects outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and L 663536 biological activity strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic purchase S28463 projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and Cibinetide dose sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the L868275 web substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: GLPG0187 cost neurology AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm BMS-5 web didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access VesatolimodMedChemExpress Vesatolimod request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits PD98059 site during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Suggested by our results are similar to others [8, 25]. Our findings for

Suggested by our results are similar to others [8, 25]. Our findings for childhood neglect agree with a US study showing faster BMI gain, 15 to 28y [8] and a Danish study showing higher obesity risk in young adulthood ( 20y) using similar parental care measures to ours [38]; whereas for courtsubstantiated neglect in the US, no excess BMI was seen at 31y [37]. Whilst differences in neglect measures may account for some discrepancies, our study suggests that associations vary with age, although reasons for this variation with age are unknown. Childhood maltreatment groups differed from their contemporaries in many aspects of their lives, such as lower qualifications and higher unemployment /smoking rates, 23y to 50y. In parallel, some maltreatment groups had lower BMI in childhood, followed by a faster rate of BMI gain and higher adult BMI. Because associations for child and adult BMI can be in opposite directions, studies of specific ages may not capture the full association of maltreatment with BMI and obesity. Child maltreatment has been linked to multiple long-term outcomes including several chronic diseases [1]. One plausible pathway through which adult health may be affected is via obesity, [3?] and excess BMI gain. BMI gain is important because even within the normal BMI range it has been linked to adverse health outcomes [39?3]. Hence, the faster BMI trajectory for some child ACY 241 web maltreatments may have detrimental health consequences in the long-term. Not all child maltreatments showed consistent associations with BMI or obesity (e.g. psychological abuse) hence, summary maltreatment measures may be inadequate to investigate long-term relationships with BMI or obesity. This is a study of one cohort and results may differ in other populations given their prevalence of child maltreatment or obesity. Future studies are needed to track long-term outcomes of child maltreatment, identify purchase ABT-737 factors that may remedy adverse outcomes, monitor younger generations and support efforts aimed at primary prevention.Supporting InformationS1 Table. OR (95 CI) for obesity (!95th percentile) at each age by childhood maltreatment (unadjusted). (DOCX) S2 Table. Changing Odds ratio (OR) (95 CIs) for obesity with age for childhood maltreatments. (DOCX) S3 Table. (1) Mean differences in zBMI (95 CIs) at 7y and rate of change in zBMI (7?0y) and (2) Changing Odds ratio (OR) (95 CIs) for obesity with age in Females. (DOCX)PLOS ONE | DOI:10.1371/journal.pone.0119985 March 26,13 /Child Maltreatment and BMI TrajectoriesAcknowledgmentsWe are grateful to participants of the 1958 British birth cohort.Author ContributionsConceived and designed the experiments: CP. Performed the experiments: SMPP LL. Analyzed the data: SMPP LL. Contributed reagents/materials/analysis tools: CP SMPP LL. Wrote the paper: CP.
Pathogenic Escherichia coli are a major source of morbidity, and less-commonly mortality, due to infections of the urinary tract, intestinal tract, and bloodstream. Most E. coli virulence factors identified to date target interactions with host intestinal epithelial cells. For instance, Esp and Nle Type III secretion system effectors from enteropathogenic (EPEC) and enterohemorrhagic (EHEC) E. coli disrupt internalization, protein secretion, NF-B signaling, MAPK signaling, and apoptosis in eukaryotic cells[1]. Certain strains of pathogenic E. coli, including the enteroaggregative E. coli, also form biofilms in the intestine, secrete toxins that cause fluid secretion fr.Suggested by our results are similar to others [8, 25]. Our findings for childhood neglect agree with a US study showing faster BMI gain, 15 to 28y [8] and a Danish study showing higher obesity risk in young adulthood ( 20y) using similar parental care measures to ours [38]; whereas for courtsubstantiated neglect in the US, no excess BMI was seen at 31y [37]. Whilst differences in neglect measures may account for some discrepancies, our study suggests that associations vary with age, although reasons for this variation with age are unknown. Childhood maltreatment groups differed from their contemporaries in many aspects of their lives, such as lower qualifications and higher unemployment /smoking rates, 23y to 50y. In parallel, some maltreatment groups had lower BMI in childhood, followed by a faster rate of BMI gain and higher adult BMI. Because associations for child and adult BMI can be in opposite directions, studies of specific ages may not capture the full association of maltreatment with BMI and obesity. Child maltreatment has been linked to multiple long-term outcomes including several chronic diseases [1]. One plausible pathway through which adult health may be affected is via obesity, [3?] and excess BMI gain. BMI gain is important because even within the normal BMI range it has been linked to adverse health outcomes [39?3]. Hence, the faster BMI trajectory for some child maltreatments may have detrimental health consequences in the long-term. Not all child maltreatments showed consistent associations with BMI or obesity (e.g. psychological abuse) hence, summary maltreatment measures may be inadequate to investigate long-term relationships with BMI or obesity. This is a study of one cohort and results may differ in other populations given their prevalence of child maltreatment or obesity. Future studies are needed to track long-term outcomes of child maltreatment, identify factors that may remedy adverse outcomes, monitor younger generations and support efforts aimed at primary prevention.Supporting InformationS1 Table. OR (95 CI) for obesity (!95th percentile) at each age by childhood maltreatment (unadjusted). (DOCX) S2 Table. Changing Odds ratio (OR) (95 CIs) for obesity with age for childhood maltreatments. (DOCX) S3 Table. (1) Mean differences in zBMI (95 CIs) at 7y and rate of change in zBMI (7?0y) and (2) Changing Odds ratio (OR) (95 CIs) for obesity with age in Females. (DOCX)PLOS ONE | DOI:10.1371/journal.pone.0119985 March 26,13 /Child Maltreatment and BMI TrajectoriesAcknowledgmentsWe are grateful to participants of the 1958 British birth cohort.Author ContributionsConceived and designed the experiments: CP. Performed the experiments: SMPP LL. Analyzed the data: SMPP LL. Contributed reagents/materials/analysis tools: CP SMPP LL. Wrote the paper: CP.
Pathogenic Escherichia coli are a major source of morbidity, and less-commonly mortality, due to infections of the urinary tract, intestinal tract, and bloodstream. Most E. coli virulence factors identified to date target interactions with host intestinal epithelial cells. For instance, Esp and Nle Type III secretion system effectors from enteropathogenic (EPEC) and enterohemorrhagic (EHEC) E. coli disrupt internalization, protein secretion, NF-B signaling, MAPK signaling, and apoptosis in eukaryotic cells[1]. Certain strains of pathogenic E. coli, including the enteroaggregative E. coli, also form biofilms in the intestine, secrete toxins that cause fluid secretion fr.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression AG-490MedChemExpress Tyrphostin AG 490 analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. Necrostatin-1 site suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of Doravirine site states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions CEP-37440 site between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the LM22A-4 web payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of HMPL-012MedChemExpress Sulfatinib recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.

……………………………………………………………………………………………………………………………………………………………..Islam0.0.0.0.0……………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………weddings0.0.0.0.0.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………10rsos.royalsocietypublishing.

……………………………………………………………………………………………………………………………………………………………..Islam0.0.0.0.0……………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………weddings0.0.0.0.0.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………10rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………no. users active in 28-day spring periodIndian politicsScottish politics nursingastronomy wildlife and animalsdogshousing sector weddings`Gamergate’ religionfriends chattinghuman resources Islam versus atheism Islam nursing Madeleine McCann smoking/e-cigarettesfriends chatting1 1 10 100 1000 no. users active in 28-day NS-018 biological activity autumn period weighted Louvain k-clique-communities 10LouvainFigure 7. The communities we studied endured strongly over a 19-week period.measures (MC) and (SS) (MC) and (L) (SS) and (L)correlation coefficient (autumn) 0.971 0.correlation coefficient (spring) 0.954 0……………………………………………………………………………………………………………………………………………………………………………………………….. ………………………………………………………………………………………………………………………………………………………………………………………………. ……………………………………………………………………………………………………………………………………………………………………………………………….0.0.Thus at the community level, the three measures are very similar.4.3. Dynamics of 3′-Methylquercetin custom synthesis sentiments in communitiesHere, we analyse the changes in sentiment/mood of our communities over time (or the lack thereof, as it generally turns out). Figure 10 plots the mean (SS) sentiment of each community over the autumn period against the mean (SS) sentiment over the spring period. We see that the sentiments persisted very strongly: the correlation between the autumn sentiment and spring sentiment is 0.982. The corresponding correlation under the (MC) measure was 0.982, and under (L) was 0.960. We looked for explanations for the (small) changes in sentiments that did occur. On the vertical axis of figure 11, we show the change in mean sentiment between the autumn period and spring period using (MC); a positive number means that the sentiment became more positive over time. On the horizontal axis, we show the mean sentiment during the autumn period. What we find is that when the sentiment is initially at the negative end of the spectrum, it tends to increase slightly; on the other hand, if the sentiment is initially at the positive end, it tends to decrease slightly. In fact, the sentiment in 16 of the 18 communities moved slightly towards a moderate (MC) value of 0.4 (which is approximately where the line of best fit cuts the horizontal axis in figure 11). This could be because extreme sentiment in a community is `whipped up’ by external events and then, once those ev………………………………………………………………………………………………………………………………………………………………Islam0.0.0.0.0……………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………weddings0.0.0.0.0.rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………10rsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………no. users active in 28-day spring periodIndian politicsScottish politics nursingastronomy wildlife and animalsdogshousing sector weddings`Gamergate’ religionfriends chattinghuman resources Islam versus atheism Islam nursing Madeleine McCann smoking/e-cigarettesfriends chatting1 1 10 100 1000 no. users active in 28-day autumn period weighted Louvain k-clique-communities 10LouvainFigure 7. The communities we studied endured strongly over a 19-week period.measures (MC) and (SS) (MC) and (L) (SS) and (L)correlation coefficient (autumn) 0.971 0.correlation coefficient (spring) 0.954 0……………………………………………………………………………………………………………………………………………………………………………………………….. ………………………………………………………………………………………………………………………………………………………………………………………………. ……………………………………………………………………………………………………………………………………………………………………………………………….0.0.Thus at the community level, the three measures are very similar.4.3. Dynamics of sentiments in communitiesHere, we analyse the changes in sentiment/mood of our communities over time (or the lack thereof, as it generally turns out). Figure 10 plots the mean (SS) sentiment of each community over the autumn period against the mean (SS) sentiment over the spring period. We see that the sentiments persisted very strongly: the correlation between the autumn sentiment and spring sentiment is 0.982. The corresponding correlation under the (MC) measure was 0.982, and under (L) was 0.960. We looked for explanations for the (small) changes in sentiments that did occur. On the vertical axis of figure 11, we show the change in mean sentiment between the autumn period and spring period using (MC); a positive number means that the sentiment became more positive over time. On the horizontal axis, we show the mean sentiment during the autumn period. What we find is that when the sentiment is initially at the negative end of the spectrum, it tends to increase slightly; on the other hand, if the sentiment is initially at the positive end, it tends to decrease slightly. In fact, the sentiment in 16 of the 18 communities moved slightly towards a moderate (MC) value of 0.4 (which is approximately where the line of best fit cuts the horizontal axis in figure 11). This could be because extreme sentiment in a community is `whipped up’ by external events and then, once those ev.

Iewees: a unique number following a character indicating type of interview

Iewees: a unique number following a character indicating type of interview (video [V], audio [A]).298 ?2014 Macmillan Nectrolide web Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsAnalysis proceeded by thematizing the data. When saturation was reached, themes were compared for congruency determining similarities and overlaps (Lincoln and Guba, 1985). The emerging themes were then refined, assigned interpretative meanings and grouped in conceptual categories. The interviews uncovered the inherent potential of the expressive arts to (1) expedite undistorted lifeworld communication, (2) facilitate the participants’ critical reflection and (3) consolidate their experiential knowledge.FindingsThe group of women in this study shares some, but not all, features of a new social movement (Scambler, 2001). The group did not engage in conspicuous public protest and the project’s resulting ethnodrama was not a coordinated form of subversion against system goals. However, the production did challenge medical discourse concerning diagnoses of, and treatments for, lymphedema and provided a platform for the participants to speak the truthfulness of the `patient voice’ to the expert culture of medicine. Akin to the new social movements, communicative rationality underpinned the social learning of the group of study participants. Their unspoken assertions embedded in their art forms expedited the exchange and scrutiny of validity claims and facilitated the exploration of alternative understandings of the lymphedema condition. The group’s exploration of the meaning of illness, disease and disability was a catalyst for critical self-reflection. The solidarities arising from the group came from matters of personal and collective identities and not from class relations, a further parallel to the new social movements. Moreover, by addressing issues pertaining to their daily lives shaped by lymphedema, the group reinforced the legitimacy of patients’ lay knowledge and moderated the effects of the strategic rationality of the medical professionals. The thematic characteristics of the group ?undistorted communication, critical reflection and consolidated lay knowledge ?will be explored in detail in the subsequent sections. Expediting undistorted lifeworld communication through popular expressive art forms In the study’s workshops, the expressive art forms were used as a point of departure for aesthetically communicative experiences among the women. Inspired by Habermasian thought, the workshop’s creative activities were introduced by the researchers as tools for individual and collective critical reflection, not for display in the City’s art gallery. The workshops were organized to optimize the simultaneously occurring processes involved in aesthetic experiences: (1) the?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et aldynamic integration of expressions of the art piece with their implicit cognitive and normative understandings; (2) subjective reactions in reference to specific objective MS023 web properties; (3) and a critical, corrective `synthesis’ of subjective confrontation and objective commentary (Seel, 1985, as cited in Ingram, 1991). The women were asked not to `overthink’ the production of their collages, but to let their intuition drive the impulse of their choices of images, or words in the case of free-writing. In addition, the parameters we placed on the proc.Iewees: a unique number following a character indicating type of interview (video [V], audio [A]).298 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsAnalysis proceeded by thematizing the data. When saturation was reached, themes were compared for congruency determining similarities and overlaps (Lincoln and Guba, 1985). The emerging themes were then refined, assigned interpretative meanings and grouped in conceptual categories. The interviews uncovered the inherent potential of the expressive arts to (1) expedite undistorted lifeworld communication, (2) facilitate the participants’ critical reflection and (3) consolidate their experiential knowledge.FindingsThe group of women in this study shares some, but not all, features of a new social movement (Scambler, 2001). The group did not engage in conspicuous public protest and the project’s resulting ethnodrama was not a coordinated form of subversion against system goals. However, the production did challenge medical discourse concerning diagnoses of, and treatments for, lymphedema and provided a platform for the participants to speak the truthfulness of the `patient voice’ to the expert culture of medicine. Akin to the new social movements, communicative rationality underpinned the social learning of the group of study participants. Their unspoken assertions embedded in their art forms expedited the exchange and scrutiny of validity claims and facilitated the exploration of alternative understandings of the lymphedema condition. The group’s exploration of the meaning of illness, disease and disability was a catalyst for critical self-reflection. The solidarities arising from the group came from matters of personal and collective identities and not from class relations, a further parallel to the new social movements. Moreover, by addressing issues pertaining to their daily lives shaped by lymphedema, the group reinforced the legitimacy of patients’ lay knowledge and moderated the effects of the strategic rationality of the medical professionals. The thematic characteristics of the group ?undistorted communication, critical reflection and consolidated lay knowledge ?will be explored in detail in the subsequent sections. Expediting undistorted lifeworld communication through popular expressive art forms In the study’s workshops, the expressive art forms were used as a point of departure for aesthetically communicative experiences among the women. Inspired by Habermasian thought, the workshop’s creative activities were introduced by the researchers as tools for individual and collective critical reflection, not for display in the City’s art gallery. The workshops were organized to optimize the simultaneously occurring processes involved in aesthetic experiences: (1) the?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et aldynamic integration of expressions of the art piece with their implicit cognitive and normative understandings; (2) subjective reactions in reference to specific objective properties; (3) and a critical, corrective `synthesis’ of subjective confrontation and objective commentary (Seel, 1985, as cited in Ingram, 1991). The women were asked not to `overthink’ the production of their collages, but to let their intuition drive the impulse of their choices of images, or words in the case of free-writing. In addition, the parameters we placed on the proc.

Anned start and need of urgent dialysis start. Population n Cause

Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) PeficitinibMedChemExpress JNJ-54781532 Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early Relugolix dose referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria Dactinomycin biological activity macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage GSK-1605786 side effects phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

Atient preferences and perceptions regarding aggressive treatment. While more white subjects

Atient preferences and perceptions regarding Ensartinib price aggressive treatment. While more white subjects indicated a willingness to participate in a clinical trial involving a new, experimental medication compared to African-Americans, this difference was not statistically significant (80.7 vs 68.7 , P = 0.10). In contrast, more whites than African-Americans were willing to receive CYC if their lupus worsened and if their doctor recommended the treatment (84.9 vs 67.0 , P = 0.02). No significant racial/ethnic differences were observed in the perceptions of effictiveness and risk of CYC. Table 3 demonstrates patient health attitudes and beliefs. Compared with whites, African-Americans were more likely to believe that BLU-554 site prayer is helpful for their lupus (P < 0.001) and to utilize prayer to cope with their disease (P < 0.01). In addition, African-American patients were more likely than whites to believe that their health outcomes are controlled by their own internal actions (P < 0.01) and by powerful others (P < 0.01). They also reported higher trust in physicians than white patients (P = 0.01).Reliability and validity of measuresReliability Supplementary Table S1 (available as supplementary data at Rheumatology Online) shows the Cronbach a coefficient values of several multi-item components of the survey. Correlational analyses Willingness to participate in a clinical trial positively correlated with willingness to receive CYC (r = 0.24, P = 0.001). Perceived effectiveness negatively correlated with perceived risk of CYC treatment (r = ?.32, P < 0.001). Trust in physicians negatively correlated with perceived discrimination in the medical setting (r = ?.60, P < 0.001). Factor analyses The results of the factor analyses are shown in supplementary Table S2 (available as supplementary data at Rheumatology Online). (1) Beliefs about CYC. Effectiveness of treatment items all loaded on Factor 1, which accounted for 70 of the variance. Familiarity with CYC items loaded on Factor 2, which accounted for 23 of the variance. (2) Trust in physicians and perceived discrimination. All trust in physicians items loaded on Factor 1, which accounted for 86 of the variance. All perceived discrimination items loaded on Factor 2, which accounted for 13 of the variance.ResultsA total of 235 SLE patients were initially considered for participation in the study. One hundred and ninety-five were eligible and consented to participate. Data from 120 African-American and 62 white patients were evaluated; 92.3 were women (Fig. 1). Participants’ sociodemographic and clinical characteristics are shown in Table 1. Statistically significant differences were observed between the racial/ethnic groups. African-American SLE patients, compared with white SLE patients, were less likely to have more education than a high-school degree (64.2 vs 83.9 , P < 0.01), were less likely to be employed (38.5 vs 56.5 , P = 0.02) and were more likely to have lower incomes (33.6 vs 5.4 with annual income of < 10 000, P < 0.001). Although African-American patients had a higher Charlson Comorbidity Index mean score than white patients (2.34 vs 1.85, P = 0.03), the mean SLEDAI score, SLICC Damage Index score, disease duration and number of immunosuppressant agents used did not differ.Preferences: bivariate analysesTable 4 shows the patient characteristics and beliefs that were significantly related to patients’ CYC treatment preference. Compared with SLE patients unwilling to receive the medicati.Atient preferences and perceptions regarding aggressive treatment. While more white subjects indicated a willingness to participate in a clinical trial involving a new, experimental medication compared to African-Americans, this difference was not statistically significant (80.7 vs 68.7 , P = 0.10). In contrast, more whites than African-Americans were willing to receive CYC if their lupus worsened and if their doctor recommended the treatment (84.9 vs 67.0 , P = 0.02). No significant racial/ethnic differences were observed in the perceptions of effictiveness and risk of CYC. Table 3 demonstrates patient health attitudes and beliefs. Compared with whites, African-Americans were more likely to believe that prayer is helpful for their lupus (P < 0.001) and to utilize prayer to cope with their disease (P < 0.01). In addition, African-American patients were more likely than whites to believe that their health outcomes are controlled by their own internal actions (P < 0.01) and by powerful others (P < 0.01). They also reported higher trust in physicians than white patients (P = 0.01).Reliability and validity of measuresReliability Supplementary Table S1 (available as supplementary data at Rheumatology Online) shows the Cronbach a coefficient values of several multi-item components of the survey. Correlational analyses Willingness to participate in a clinical trial positively correlated with willingness to receive CYC (r = 0.24, P = 0.001). Perceived effectiveness negatively correlated with perceived risk of CYC treatment (r = ?.32, P < 0.001). Trust in physicians negatively correlated with perceived discrimination in the medical setting (r = ?.60, P < 0.001). Factor analyses The results of the factor analyses are shown in supplementary Table S2 (available as supplementary data at Rheumatology Online). (1) Beliefs about CYC. Effectiveness of treatment items all loaded on Factor 1, which accounted for 70 of the variance. Familiarity with CYC items loaded on Factor 2, which accounted for 23 of the variance. (2) Trust in physicians and perceived discrimination. All trust in physicians items loaded on Factor 1, which accounted for 86 of the variance. All perceived discrimination items loaded on Factor 2, which accounted for 13 of the variance.ResultsA total of 235 SLE patients were initially considered for participation in the study. One hundred and ninety-five were eligible and consented to participate. Data from 120 African-American and 62 white patients were evaluated; 92.3 were women (Fig. 1). Participants’ sociodemographic and clinical characteristics are shown in Table 1. Statistically significant differences were observed between the racial/ethnic groups. African-American SLE patients, compared with white SLE patients, were less likely to have more education than a high-school degree (64.2 vs 83.9 , P < 0.01), were less likely to be employed (38.5 vs 56.5 , P = 0.02) and were more likely to have lower incomes (33.6 vs 5.4 with annual income of < 10 000, P < 0.001). Although African-American patients had a higher Charlson Comorbidity Index mean score than white patients (2.34 vs 1.85, P = 0.03), the mean SLEDAI score, SLICC Damage Index score, disease duration and number of immunosuppressant agents used did not differ.Preferences: bivariate analysesTable 4 shows the patient characteristics and beliefs that were significantly related to patients’ CYC treatment preference. Compared with SLE patients unwilling to receive the medicati.

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells

Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; SulfatinibMedChemExpress Sulfatinib Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed SCIO-469 web accordingly (Bandari et al., 2014; Bijt.Ic dependent invasive and proteolytic mesenchymal response in breast carcinoma cells in vitro and in vivo.133 Under hypoxic conditions, increased cell invasion of tumor cells was also mediated by Rab4 dependent recycling and translocation of furin, which interacts with the cytoskeletal protein filamin A at the cell surface.ConclusionAs the role of growth-factor driven endocytosis in metastasis is slowly being characterized, part of the struggle that currently exists involves the correct identification of the crucial endocytic molecules that may be potential therapeutic targets in cancer treatment. These observations may include but, are not limited to Rab5, and its effectors the GEFs such as Rab interference 1 (RIN1) and GAPs. As outlined lined above, there is a paucity of research specifically regarding the relationship between Rab GTPases and growth factors, particularly IGF-1, in cancer cell migration and invasion. While most Rabs are currently not considered to be oncogenic, there is growing evidence that may suggest otherwise. Endocytosis is an indispensable signaling mechanism in growthfactor induced signaling, so that it is worth considering the early factors such as Rab5 that exert a great influence on intracellular trafficking and also as a coordinator in the crosstalk among signaling pathways in propagating and promoting metastasis (Fig. 1). Further description of Rab function in cancer cell
In intensive care units (ICUs), which mostly serve patients with severe health problems, healthcare workers need to make decisions that are simultaneously swift and correct. In the complex nature of this environment, the needs of the patient’s relatives might be seen as the lowest priority (Mendonca Warren, 1998). On the other hand, because of the patient’s critical and often uncertain condition, the family’s stress levels are often quite highHow to cite this article B?y?kcoban et al. (2015), Adaptation of the Critical Care Family Need Inventory to the Turkish population and u u ?its psychometric properties. PeerJ 3:e1208; DOI 10.7717/peerj.(Ozgursoy Akyol, 2008). Meeting relatives’ needs–to be informed clearly and honestly, for example–might reduce their stress (Kutlu, 2000; Price et al., 1991; Siddiqui, Sheikh Kamal, 2011). Physicians and especially critical care nurses are in the best position to help relatives (Leske, 1986; Ozgursoy Akyol, 2008). However, relevant literature studies have shown that the specific needs and concerns of relatives of critical care patients are not properly met (Curry, 1995; Kleinpell Powers, 1992), and the most cited reason for not meeting the needs is misjudgement of the importance of those needs (Johnson et al., 1995; Leung, Chien Mackenzie, 2000). Thus, determining and understanding the dimensions of relatives’ needs seems the first step toward improving quality of service, and also for exercising a major patient right–to be informed in a thorough and timely manner. Molter (1979), who conducted one of the earliest studies on the needs of critical care patients’ relatives, constructed a needs list. Leske modified this list and titled it Critical Care Family Need Inventory (CCFNI) (Leske, 1991), defined its aim as determining the level of importance of relatives’ needs and developing a tool for clinics to measure categories of family needs. The inventory has been adapted into various languages and cultures, and validity and reliability studies performed accordingly (Bandari et al., 2014; Bijt.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential PD150606 manufacturer mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger AZD4547 supplement predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

Ed the kinship claims, which were fundamentally about quality of care.

Ed the kinship claims, which were fundamentally about quality of care. However, there is the devastating potential that the legal and kinship claims might contradict each other, which creates insecurities for caregivers and children. The Nthos, an elderly couple in their seventies, were also caring for their maternal grandchildren because their daughter migrated with her children to her natal home during the late stages of her illness. Both the mother and youngest child were HIV-positive. The grandfather, Ntate Bokang, said, ‘The parents on the BAY 11-7085 custom synthesis father’s side were not taking care of the mother … They were not taking care at all’. However, these maternal grandparents felt deeply insecure about the lack of formality in their arrangement: Grandfather: When we die, what is going to happen? Because we don’t have a boy. What is going to happen to our houses? I don’t know … Grandmother: Me,I just think what if Ntate-Moholo [grandfather] and I, we can both die, who is going to take care of these children of my daughter? Because we are the ones taking care of them. Because, on the father’s side, they seem not to take care of them. And I’m always praying to God to help me so that I can live for a long time and they should be old enough to do things for themselves.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptJ R Anthropol Inst. Author manuscript; available in PMC 2015 April 08.BlockPageAlthough the paternal family had shown no interest in caring for the children, the Nthos harboured concerns about the children’s future. Ntate Bokang said, ‘Because we are the parents of their mother we have to take care of them. When they grow up and if they want to go to that family [father’s side] they will go because they are still using their surname (fane)’. The unspoken concern was that once the children were old enough to make significant contributions to the household, especially in terms of agricultural work, the paternal family would want them back. The Nthos’ substantial caregiving investment was not enough to ensure that the children belonged to them. When the Nthos’ daughter married her husband, he paid four cows, an acceptable initial payment at the time of marriage. This partial payment created insecurity for the Ntho family. The emphasis on bridewealth payments in negotiating caregiver rights is notable because in practice bridewealth is a fading, though not extinct, practice among Basotho. Historically, bridewealth reinforced the processual nature of a union, whereby an initial payment was made at the time of marriage, with the remaining cows (or agreed-upon equivalent of cash, goods, or other animals) paid over time (Ashton 1967; Murray 1981). Contemporary marriage, though less reliant on bridewealth, is still conceived as a process as opposed to an event (Comaroff Comaroff 2001; Murray 1976; N.W. Townsend 1997). While many Basotho participate in legal and/or customary marriage ceremonies, others consider cohabitation to Enzastaurin biological activity signify the start of their marriage. As a result, the marital status of a couple, and consequently the appropriate caregiver for orphans, is less obvious and more open to negotiation. Elderly Basotho are more likely than young people to extol the value of bridewealth in strengthening a marriage, and conversely to attribute the dissolution of marriages to the decline in bridewealth practices. Indeed, several elderly Basotho told me that when they fought with their spouses, their parents encouraged the.Ed the kinship claims, which were fundamentally about quality of care. However, there is the devastating potential that the legal and kinship claims might contradict each other, which creates insecurities for caregivers and children. The Nthos, an elderly couple in their seventies, were also caring for their maternal grandchildren because their daughter migrated with her children to her natal home during the late stages of her illness. Both the mother and youngest child were HIV-positive. The grandfather, Ntate Bokang, said, ‘The parents on the father’s side were not taking care of the mother … They were not taking care at all’. However, these maternal grandparents felt deeply insecure about the lack of formality in their arrangement: Grandfather: When we die, what is going to happen? Because we don’t have a boy. What is going to happen to our houses? I don’t know … Grandmother: Me,I just think what if Ntate-Moholo [grandfather] and I, we can both die, who is going to take care of these children of my daughter? Because we are the ones taking care of them. Because, on the father’s side, they seem not to take care of them. And I’m always praying to God to help me so that I can live for a long time and they should be old enough to do things for themselves.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptJ R Anthropol Inst. Author manuscript; available in PMC 2015 April 08.BlockPageAlthough the paternal family had shown no interest in caring for the children, the Nthos harboured concerns about the children’s future. Ntate Bokang said, ‘Because we are the parents of their mother we have to take care of them. When they grow up and if they want to go to that family [father’s side] they will go because they are still using their surname (fane)’. The unspoken concern was that once the children were old enough to make significant contributions to the household, especially in terms of agricultural work, the paternal family would want them back. The Nthos’ substantial caregiving investment was not enough to ensure that the children belonged to them. When the Nthos’ daughter married her husband, he paid four cows, an acceptable initial payment at the time of marriage. This partial payment created insecurity for the Ntho family. The emphasis on bridewealth payments in negotiating caregiver rights is notable because in practice bridewealth is a fading, though not extinct, practice among Basotho. Historically, bridewealth reinforced the processual nature of a union, whereby an initial payment was made at the time of marriage, with the remaining cows (or agreed-upon equivalent of cash, goods, or other animals) paid over time (Ashton 1967; Murray 1981). Contemporary marriage, though less reliant on bridewealth, is still conceived as a process as opposed to an event (Comaroff Comaroff 2001; Murray 1976; N.W. Townsend 1997). While many Basotho participate in legal and/or customary marriage ceremonies, others consider cohabitation to signify the start of their marriage. As a result, the marital status of a couple, and consequently the appropriate caregiver for orphans, is less obvious and more open to negotiation. Elderly Basotho are more likely than young people to extol the value of bridewealth in strengthening a marriage, and conversely to attribute the dissolution of marriages to the decline in bridewealth practices. Indeed, several elderly Basotho told me that when they fought with their spouses, their parents encouraged the.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and Leupeptin (hemisulfate) site higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone web journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two T0901317 clinical trials water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a Thonzonium (bromide) supplement footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and LIMKI 3 msds expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal CBR-5884 supplier paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile PD173074 dose collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly EPZ004777 manufacturer expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.3-Methyladenine web alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of UNC0642 dose adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and Sodium lasalocidMedChemExpress Sodium lasalocid additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work JC-1 chemical information venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Iological Characteristics in Habitats of High and Low Presence of Anopheline

Iological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Hexanoyl-Tyr-Ile-Ahx-NH2 site western Kenya HighlandsBryson A. Ndenga1,2*, Jemimah A. Simbauni1, Jenard P. Mbugi1, Andrew K. Githeko1 Department of Zoological Sciences, Kenyatta University, Nairobi, Kenya, 2 Centre for Global Health Research, Kenya Medical Research Institute, Kisumu, KenyaAbstractBackground: Characteristics of aquatic habitats determine whether mosquitoes will oviposit, hatch, develop, pupate and successfully emerge into adults or not, thus influencing which mosquito species will occupy a habitat. This study determined whether physiochemical and biological characteristics differ between habitats with high and low presence of anopheline larvae. Methods: Physical, chemical and biological characteristics were evaluated in selected habitats twice per month within three highland valleys in western Kenya. Aquatic macro-organisms were sampled using a sweep-net. Colorimetric methods were used to determine levels of iron, phosphate, nitrate, ammonium and nitrite in water samples. Generalized Estimating Equations (GEE) was used to compare parameters between the two categories of anopheline presence. Results: Habitats with high anopheline presence had greater abundance of mosquito aquatic stages and tadpoles and two times more levels of nitrate in water, whereas habitats with low anopheline presence had wider biofilm cover and higher levels of iron in water. Conclusion: Habitats of high and low presence of anopheline larvae, which differed in a number of physical, chemical and biological characteristics, were identified in valleys within western Kenya highlands. Differences in habitat characteristics are critical in determining the number of anopheline larvae that will fully develop and emerge into adults.Citation: Ndenga BA, Simbauni JA, Mbugi JP, Githeko AK (2012) Physical, Chemical and Biological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Western Kenya Highlands. PLoS ONE 7(10): e47975. doi:10.1371/journal.pone.0047975 Editor: Olle Terenius, Swedish University of Agricultural Sciences, Sweden Received May 28, 2012; Accepted September 19, 2012; Published October 23, 2012 Copyright: ?2012 Ndenga et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was funded by the World Health Organization (WHO) Special Programme for Research and Training in Tropical Diseases (TDR)-Research Training Grant (RTG) and Valent BioSciences Corporation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: This research study received part of its funding from a buy AICAR commercial source “Valent BioSciences Corporation”. The authors declare that they have no competing interest relating to employment, consultancy, patents, and products in development or on the market. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. * E-mail: [email protected] habitats are an important component of the process that results in malaria transmission. Mosquito life cycle processes including oviposition, larval development, pupation and emergence occur in aquatic habitats. These habitats are crucial in determining the types of.Iological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Western Kenya HighlandsBryson A. Ndenga1,2*, Jemimah A. Simbauni1, Jenard P. Mbugi1, Andrew K. Githeko1 Department of Zoological Sciences, Kenyatta University, Nairobi, Kenya, 2 Centre for Global Health Research, Kenya Medical Research Institute, Kisumu, KenyaAbstractBackground: Characteristics of aquatic habitats determine whether mosquitoes will oviposit, hatch, develop, pupate and successfully emerge into adults or not, thus influencing which mosquito species will occupy a habitat. This study determined whether physiochemical and biological characteristics differ between habitats with high and low presence of anopheline larvae. Methods: Physical, chemical and biological characteristics were evaluated in selected habitats twice per month within three highland valleys in western Kenya. Aquatic macro-organisms were sampled using a sweep-net. Colorimetric methods were used to determine levels of iron, phosphate, nitrate, ammonium and nitrite in water samples. Generalized Estimating Equations (GEE) was used to compare parameters between the two categories of anopheline presence. Results: Habitats with high anopheline presence had greater abundance of mosquito aquatic stages and tadpoles and two times more levels of nitrate in water, whereas habitats with low anopheline presence had wider biofilm cover and higher levels of iron in water. Conclusion: Habitats of high and low presence of anopheline larvae, which differed in a number of physical, chemical and biological characteristics, were identified in valleys within western Kenya highlands. Differences in habitat characteristics are critical in determining the number of anopheline larvae that will fully develop and emerge into adults.Citation: Ndenga BA, Simbauni JA, Mbugi JP, Githeko AK (2012) Physical, Chemical and Biological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Western Kenya Highlands. PLoS ONE 7(10): e47975. doi:10.1371/journal.pone.0047975 Editor: Olle Terenius, Swedish University of Agricultural Sciences, Sweden Received May 28, 2012; Accepted September 19, 2012; Published October 23, 2012 Copyright: ?2012 Ndenga et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was funded by the World Health Organization (WHO) Special Programme for Research and Training in Tropical Diseases (TDR)-Research Training Grant (RTG) and Valent BioSciences Corporation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: This research study received part of its funding from a commercial source “Valent BioSciences Corporation”. The authors declare that they have no competing interest relating to employment, consultancy, patents, and products in development or on the market. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. * E-mail: [email protected] habitats are an important component of the process that results in malaria transmission. Mosquito life cycle processes including oviposition, larval development, pupation and emergence occur in aquatic habitats. These habitats are crucial in determining the types of.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been Beclabuvir biological activity trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and HS-173 dose diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Axonomy of learning aims, avoids assessment that rests on low ability.

Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The get SCR7 effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR Linaprazan web framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.Axonomy of learning aims, avoids assessment that rests on low ability. AR designers may use the learning outcomes, which are explained in Tables 1-4, to analyze a GP’s personal paradigm and to design their AR program. The effectiveness of the strategies and the appropriateness of the goals require further evaluation and refinement. The second implication of MARE for an AR developer is the function framework. It may help developers understand how to create mixed environments for learning, not just forJMIR Medical Education 2015 | vol. 1 | iss. 2 | e10 | p.14 (page number not for citation purposes)LimitationsThis is the first AR framework based on learning theory with clear objectives for guiding the design, development, and application of mobile AR in medical education. To date, there is no standard methodology for designing an AR framework. MARE uses a CFAM, which is based on a theory that provides systematic understanding of the multidisciplinary, complex relationship from knowledge to practice in medical education. However, this MARE framework created through a CFAM from multidisciplinary publications and reference materials must be tested in practice. Validation of the framework was suggested by Jabareen [24], but he did not give a method for how to validate it. We checked the internal validity by involving authors from different disciplines and perspectives to reduce the bias. We also used this framework for analysis of, and application in, GPs’ rational use of antibiotics. However, since this is a general framework for guiding the design, development, and application of AR in medical education, external validity, which is transferable in qualitative research, must be further tested with users and with the next step to develop an AR app. In addition, a number of experts such as instructional designers, AR developers, GPs, medical educators, visual designers, information and communications technology (ICT) specialists, and interactionhttp://mededu.jmir.org/2015/2/e10/XSL?FORenderXJMIR MEDICAL EDUCATION technology-driven infotainment. Different environments offer different learning functions. AR developers may use the list of teaching activities shown with the MARE framework as guidance when they consider how to develop AR functions. In terms of the learning objective, learning environment, learning activities, GP personal paradigm, and therapeutic process, AR developers may think about how to build interactive models and interactive levels between MARE and GPs in different environments. The learning materials in different environments must be designed and developed. Another implication of MARE for GP educators and researchers is the new technology and learning activity supported by learning theory, which corresponds to technology characters. GP educators and researchers may integrate it in their instructional practice. They can use the list of broader opportunities of MARE outcomes to compare with their students’ learning needs to design an app. The framework could be used to guide other drug or therapeutic intervention education.Zhu et al do one, teach one–in medical education, which hinders its educational function. This paper has described a framework for guiding the design, development, and application of MARE to health care education. This includes consideration of a foundation, a function, and a series of outcomes. The foundation based upon three learning theories enhances the relationship between practice and learning. The fu.

Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines

Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines, and Culture ConditionsThe non-pathogenic murine E. coli strain NC101 was isolated as described previously[24]. E. coli strain O157:H7 was a kind gift from Dr. Ann Matthysse at UNC, Chapel Hill. E. coli were grown in Luria-Burtani (LB) broth at 37 with shaking at 250 rpm. The J774 murine macrophage and L929 fibroblast cell lines were originally obtained from ATCC (Manassas, VA) and cultured in RPMI containing 10 fetal bovine serum (FBS), 100U/mL penicillin, 1000 g/mL streptomycin, and 10mM glutamine in 37 humidified incubators with 5 CO2. Conditioned media from L929 cells was used as a source of macrophage colony stimulating factor (M-CSF) for the production of bone marrow-derived macrophages (BMDMs) and was made as described previously[25]. The mutant E. coli NC101 strain STI-571 biological activity lacking ibpA and ibpB (NC101ibpAB) that was used in this study had been generated previously using the -red PX-478 site recombinase method[23,26]. We used identical methods to create a mutant E. coli O157:H7 strain that lacks ibpA and ibpB (O157: H7ibpAB). However, since the pCP20 plasmid encoding Flp recombinase failed to induce recombination at the FRT sites in E. coli O157:H7, we used strains of NC101ibpAB and O157: H7ibpAB that still contained the kanamycin resistance gene. Mutant E. coli NC101 lacking oxyS (NC101oxyS) was also generated using the -red recombinase method. Primers 5’GCATAGCAACGAACGATTATCCCTATCAAGCATTCTGACTGTGTAGGCTGGAGCTGCTTC and 5′ ACCGTTACTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATCATATGAATATCCTCCTTAGTTCC were used to amplify the kanamycin resistance cassette from pKD4. Transformation and site-specific recombination of the PCR product into the oxyS locus on the E. coli NC101 chromosome followed by excision of the kanamycin resistance gene using pCP20 was performed as previously described[23,26]. Recombinant bacterial cell lines were generated in accordance with procedures outlined by the Environmental Health and Safety Department at University of North Carolina at Chapel Hill.Mouse Strains and Production of Bone Marrow-Derived MacrophagesWild-type, gp91phox-/-, and Inos-/- mice (all on the C57/B6 genetic background) were originally obtained from Jackson Laboratories and maintained in specific-pathogen-free conditions in Department of Lab and Animal Medicine facilities at UNC, Chapel Hill. All animal protocols were approved by the UNC-Chapel Hill Institutional Animal Care and Use Committee. Bone marrow derived macrophages (BMDMs) were obtained similar to methods described previously[27]. Briefly, bone marrow was harvested from femurs and tibias of mice by flushing marrow cavities with sterile RPMI through a 26G needle and red cells lysed with 0.8 ammonium chloride for 5 minutes. After washing twice with RPMI containing 10 FBS, 2.5 x 107 cells/ plate were added to 25cm petri dishes in 50mL RPMI/10 FBS/100U/mL penicillin/ 1000 g/ mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media. Three days later, 10mL of RPMI/10 FBS/100U/mL penicillin/ 1000 g/mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media was added to each plate. On day 6, adherent cells (BMDMs) were removed with TrypLE-Express (Invitrogen), counted, and plated into experimental wells.Gentamicin Protection AssaysIntra-macrophage bacterial survival assays were performed as described previously[14,23]. Briefly, approximately 10 mid-log phase bacteria/cell were added to 5?.5 x 105 BMDMs/well in 12-well plates in a tot.Nsal E. coli against ROSMaterials and Methods Bacterial Strains, Cells Lines, and Culture ConditionsThe non-pathogenic murine E. coli strain NC101 was isolated as described previously[24]. E. coli strain O157:H7 was a kind gift from Dr. Ann Matthysse at UNC, Chapel Hill. E. coli were grown in Luria-Burtani (LB) broth at 37 with shaking at 250 rpm. The J774 murine macrophage and L929 fibroblast cell lines were originally obtained from ATCC (Manassas, VA) and cultured in RPMI containing 10 fetal bovine serum (FBS), 100U/mL penicillin, 1000 g/mL streptomycin, and 10mM glutamine in 37 humidified incubators with 5 CO2. Conditioned media from L929 cells was used as a source of macrophage colony stimulating factor (M-CSF) for the production of bone marrow-derived macrophages (BMDMs) and was made as described previously[25]. The mutant E. coli NC101 strain lacking ibpA and ibpB (NC101ibpAB) that was used in this study had been generated previously using the -red recombinase method[23,26]. We used identical methods to create a mutant E. coli O157:H7 strain that lacks ibpA and ibpB (O157: H7ibpAB). However, since the pCP20 plasmid encoding Flp recombinase failed to induce recombination at the FRT sites in E. coli O157:H7, we used strains of NC101ibpAB and O157: H7ibpAB that still contained the kanamycin resistance gene. Mutant E. coli NC101 lacking oxyS (NC101oxyS) was also generated using the -red recombinase method. Primers 5’GCATAGCAACGAACGATTATCCCTATCAAGCATTCTGACTGTGTAGGCTGGAGCTGCTTC and 5′ ACCGTTACTATCAGGCTCTCTTGCTGTGGGCCTGTAGAATCATATGAATATCCTCCTTAGTTCC were used to amplify the kanamycin resistance cassette from pKD4. Transformation and site-specific recombination of the PCR product into the oxyS locus on the E. coli NC101 chromosome followed by excision of the kanamycin resistance gene using pCP20 was performed as previously described[23,26]. Recombinant bacterial cell lines were generated in accordance with procedures outlined by the Environmental Health and Safety Department at University of North Carolina at Chapel Hill.Mouse Strains and Production of Bone Marrow-Derived MacrophagesWild-type, gp91phox-/-, and Inos-/- mice (all on the C57/B6 genetic background) were originally obtained from Jackson Laboratories and maintained in specific-pathogen-free conditions in Department of Lab and Animal Medicine facilities at UNC, Chapel Hill. All animal protocols were approved by the UNC-Chapel Hill Institutional Animal Care and Use Committee. Bone marrow derived macrophages (BMDMs) were obtained similar to methods described previously[27]. Briefly, bone marrow was harvested from femurs and tibias of mice by flushing marrow cavities with sterile RPMI through a 26G needle and red cells lysed with 0.8 ammonium chloride for 5 minutes. After washing twice with RPMI containing 10 FBS, 2.5 x 107 cells/ plate were added to 25cm petri dishes in 50mL RPMI/10 FBS/100U/mL penicillin/ 1000 g/ mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media. Three days later, 10mL of RPMI/10 FBS/100U/mL penicillin/ 1000 g/mL streptomycin/25ng/mL Fungizone/10 conditioned L929 media was added to each plate. On day 6, adherent cells (BMDMs) were removed with TrypLE-Express (Invitrogen), counted, and plated into experimental wells.Gentamicin Protection AssaysIntra-macrophage bacterial survival assays were performed as described previously[14,23]. Briefly, approximately 10 mid-log phase bacteria/cell were added to 5?.5 x 105 BMDMs/well in 12-well plates in a tot.

Anned start and need of urgent dialysis start. Population n Cause

Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Dalfopristin web reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early SNDX-275 web referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic Necrostatin-1MedChemExpress Necrostatin-1 regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ MK-8742 solubility predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Esses were minimal; for instance, the range of images for the

Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with EPZ004777 molecular weight immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it GW0742MedChemExpress GW610742 possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.Esses were minimal; for instance, the range of images for the collages specified by the researchers was large enough to not hamper creative inclinations. All but one of the workshop participants met the expressive art activities with immediate enthusiasm. In her post-workshop interview, one expressed reservations about her `artistic’ abilities. She reported that during the workshop she had felt her abilities were not as well honed as those of the other women. At the same time, she found the experience of producing her collage and installation to be `very powerful’ (A#4). Others noted the general level of eagerness and energetic participation among the group members: `there was nobody that didn’t want to come to my display, did you see anybody that held back? No, it was “here I go, zoom!”‘ (A#3). Apart from the one woman who initially hesitated, the group seized upon the activities, accepting the premise of the popular art forms: the only required expertise was their lived experience, not the technical aspects of the artistic creation. In the post-workshop interviews, the women reflected on the communicative power of the art forms used in the workshops. `When we did the collages and you got together and it amazed me how people had put such thought and pulled symbols that hit you immediately. … how people chose to express themselves … they told stories … it hit you with all your senses because it was visual, there was audio, you could feel it’. (A#3). The images of the collages and installations made it possible for the women to express the unsayable. The images `spoke’ for themselves, some quite loudly. Some images were quite literal, which strengthened their representational power. When assembling her installation at home (Figure 1), one participant recalled asking herself, `How do I see my life now?’ She turned to compression sleeves, which she thought `are so icky, so maybe I should put a couple of my new sleeves on there. But then I thought, “No, this is what it’s like. They get this way’. Therefore, the installation is `like hanging up my dirty laundry. My life every day. It’s thinking about my boob, what I’m going to wear today, how I can make it comfortable … every day I’m reminded of cancer … . The installation is what life is, represented by the icky sleeves, and what it would have been but can’t be anymore, represented by the new sleeves’. A woman’s arm took prominence in one collage (Figure 2) by its placement in the centre, its three-dimensionality and disproportionately large size relative to300 ?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?Aesthetic rationality of the popular expressive artsFigure 1: Sleeve installation.Figure 2: Protruding arm collage.its associated body. The `large’ arm was cut out from one picture and glued onto a different body to protrude outwards from the collage. The open-endedness of the images’ interpretability provided safety for the women to discuss subjects that might otherwise be difficult. Several commented on feelings of safety in the discussions focused on the creations: `they bring out some very private thoughts that you probably wouldn’t share otherwise … and?2014 Macmillan Publishers Ltd. 1477-8211 Social Theory Health Vol. 12, 3, 291?12Quinlan et alwe have the right to express it or not express it or take it out if we choose, if it doesn’t fit we can take it out so, you know there’s some safety’ (V#4). The collages and installations provok.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of AZD3759 web emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This MS023 web framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much buy ARQ-092 clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside HM61713, BI 1482694 site option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; GW856553X price available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, MG-132 custom synthesis agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, BAY 11-7085 chemical information whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and order Pyrvinium embonate definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Were missed or remained unexplored by study authors. In our discussion

Were missed or remained unexplored by study authors. In our discussion of findings we pointed to areas for further inquiry that may allow for discerning additional opinions and experiences. Reviewer bias The first-named author conducted the literature search, but the criteria for selection were chosen by both the first and second authors. In addition, while the analysis of the literature and subsequent synthesis statements were produced by the first two authors, the third author provided a thorough check of methods and conclusions. In this way, the potential for reviewer bias was reduced. The first and third named authors are paediatricians with interests in neonatal care. Such experience may have resulted in a bias towards clinician perspectives. Both the second and third named authors are members of the HSD-N project, and they may have been influenced by this association.ConclusionTask-shifting interventions in sub-Saharan Africa have expanded far beyond the HIV sector for which they were initially developed. Although most of the evidence around taskshifting interventions is quantitative, a growing number of qualitative studies is emerging from sub-Saharan Africa. Qualitative studies suggest that task-shifting interventions may carry important short-term and long-term implications for all cadres of health workers. Findings in this review are based on a small number of relatively short studies with several methodological limitations. Based on the data available, it appears that task shifting may negatively impact health workers’ sense of agency and ability to perform their work if not carefully designed. Established health professionals have been concerned that task shifting is diminishing their role in the health system. Lower cadres assuming new tasks appear to be highly order ML390 motivated to meet workplace demands and provide patient care. However, assuming new tasks may be occurring at the expense of high work burden, performing tasks beyond one’s scope of practice and potentially compromising patient ML390 chemical information safety. Task-shifting programmes have often been perceived as cost-saving interventions, but this may have contributed to unacceptably low remuneration and career progression options for health workers, especially in rural areas. On a positive note, some task-shifting interventions appeared to have resulted in improved communication within health teams and enabled a more rational distributionof work, especially when administrative tasks were being delegated. Some of the areas warranting further qualitative inquiry include opportunity cost of task shifting for health workers, patients’ experiences with task-shifting interventions and patient’s safety. Many limitations of task-shifting programmes arise from limitations inherent to weak, poorly resourced health systems in sub-Saharan Africa. We acknowledge that the certainty and transferability of our literature review findings are limited by the number of qualitative studies available and methodological shortcomings of individual studies. Nevertheless, literature review allowed us to examine first-hand experiences and challenges arising from the field and thus complemented more general recommendations and guidelines set by the WHO and other organisations. As mentioned in the abstract, in addition to informing a broad audience of policy makers, this review aims to provide practical guidance to an ongoing project in Kenya. Task shifting as a potential intervention in Nairobi’s neonatal nurseries s.Were missed or remained unexplored by study authors. In our discussion of findings we pointed to areas for further inquiry that may allow for discerning additional opinions and experiences. Reviewer bias The first-named author conducted the literature search, but the criteria for selection were chosen by both the first and second authors. In addition, while the analysis of the literature and subsequent synthesis statements were produced by the first two authors, the third author provided a thorough check of methods and conclusions. In this way, the potential for reviewer bias was reduced. The first and third named authors are paediatricians with interests in neonatal care. Such experience may have resulted in a bias towards clinician perspectives. Both the second and third named authors are members of the HSD-N project, and they may have been influenced by this association.ConclusionTask-shifting interventions in sub-Saharan Africa have expanded far beyond the HIV sector for which they were initially developed. Although most of the evidence around taskshifting interventions is quantitative, a growing number of qualitative studies is emerging from sub-Saharan Africa. Qualitative studies suggest that task-shifting interventions may carry important short-term and long-term implications for all cadres of health workers. Findings in this review are based on a small number of relatively short studies with several methodological limitations. Based on the data available, it appears that task shifting may negatively impact health workers’ sense of agency and ability to perform their work if not carefully designed. Established health professionals have been concerned that task shifting is diminishing their role in the health system. Lower cadres assuming new tasks appear to be highly motivated to meet workplace demands and provide patient care. However, assuming new tasks may be occurring at the expense of high work burden, performing tasks beyond one’s scope of practice and potentially compromising patient safety. Task-shifting programmes have often been perceived as cost-saving interventions, but this may have contributed to unacceptably low remuneration and career progression options for health workers, especially in rural areas. On a positive note, some task-shifting interventions appeared to have resulted in improved communication within health teams and enabled a more rational distributionof work, especially when administrative tasks were being delegated. Some of the areas warranting further qualitative inquiry include opportunity cost of task shifting for health workers, patients’ experiences with task-shifting interventions and patient’s safety. Many limitations of task-shifting programmes arise from limitations inherent to weak, poorly resourced health systems in sub-Saharan Africa. We acknowledge that the certainty and transferability of our literature review findings are limited by the number of qualitative studies available and methodological shortcomings of individual studies. Nevertheless, literature review allowed us to examine first-hand experiences and challenges arising from the field and thus complemented more general recommendations and guidelines set by the WHO and other organisations. As mentioned in the abstract, in addition to informing a broad audience of policy makers, this review aims to provide practical guidance to an ongoing project in Kenya. Task shifting as a potential intervention in Nairobi’s neonatal nurseries s.

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area

Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly Biotin-VAD-FMK site recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded Pristinamycin IA structure specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.Early widening towards posterior margin. Mediotergite 1 sculpture: mostly sculptured, excavated area centrally with transverse striation inside and/or a polished knob centrally on posterior margin of mediotergite. Mediotergite 2 width at posterior margin/length: 3.2?.5. Mediotergite 2 sculpture: more or less fully sculptured, with longitudinal striation. Outer margin of hypopygium: with a wide, medially folded, transparent, semi esclerotized area; usually with 4 or more pleats. Ovipositor thickness: about same width throughout its length. Ovipositor sheaths length/metatibial length: 1.0?.1. Length of fore wing veins r/2RS: 1.7?.9. Length of fore wing veins 2RS/2M: 0.9?.0. Length of fore wing veins 2M/(RS+M)b: 0.9?.0. Pterostigma length/width: 2.1?.5. Point of insertion of vein r in pterostigma: about half way point length of pterostigma. Angle of vein r with fore wing anterior margin: more or less perpendicular to fore wing margin. Shape of junction of veins r and 2RS in fore wing: distinctly but not strongly angled. Male. Similar to female, except for shape of mediotergite 1 which is more rectangular, and coloration of meso and metafemur which tends to be darker in some specimens. Molecular data. Sequences in BOLD: 16, barcode compliant sequences: 15, haplotypes: 2. Biology/ecology. Gregarious. Mostly recorded from Lepidoptera species on stored products ts cosmopolitan distribution is likely due to human transfer from an unknown source. Hosts: Gelechiidae, Lasiocampidae, Lecithoceridae, Lymantriidae, Pyralidae, Thaumetopoeidae, Tineidae, Tortricidae, Zygaenidae. The correctness of some of these host records is questionable because it is unlikely that a single species has such a wide host range. Distribution. Cosmopolitan, this species has been recorded from 50 countries in all continents but there is no suggestion that it occurs in ACG.Review of Apanteles sensu stricto (Hymenoptera, Braconidae, Microgastrinae)…Comments. The geographical coverage of the barcoded specimens includes Canada and New Zealand, but all sequences are almost identical. The only exceptions are some extralimital specimens (British Columbia, Canada) which seem to represent a different species based on body color and the barcode of one specimen. Because those specimens are not from Mesoamerica, they will be dealt with elsewhere. Apanteles christianzunigai Fern dez-Triana, sp. n. http://zoobank.org/7E1ED712-0B24-443C-9663-683070D45C9B http://species-id.net/wiki/Apanteles_christianzunigai Figs 105, 277 Apanteles Rodriguez86 (Smith et al. 2006). Interim name provided by the authors. Type locality. COSTA RICA, Guanacaste, ACG, Sector Pitilla, Sendero Trichoptera, 655m, 10.98571, -85.41869. Holotype. in CNC. Specimen labels: 1. Voucher: D.H.Janzen W.Hallwachs, DB: http://janzen.sas.upenn.edu, Area de Conservaci Guanacaste, COSTA RICA, 09-SRNP-32760. 2. DHJPAR0039745. Paratypes. 3 , 1 (CNC, NMNH). COSTA RICA, ACG database codes: DHJPAR00215, DHJPAR0038242, DHJPAR0038323, DHJPAR0038349. Description. Female. Body color: body mostly dark except for some sternites which may be pale. Antenna color: scape, pedicel, and flagellum dark. Coxae color (pro-, meso-, metacoxa): dark, dark, dark. Femora color (pro-, meso-, metafemur): pale, dark, dark. Tibiae color (pro-, meso-, metatibia): pale, pale, anteriorly pale/posteriorly dark. Tegula and humeral complex color: tegula pale, humeral complex dark. Pterostigma color: dark. Fore wing veins color: mostly dark (a few veins ma.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of Avasimibe side effects various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/GW 4064 site Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ients or the finer points of copyright law. Curious how a

Ients or the finer points of copyright law. Curious how a larger organisation might have responded, I contacted the Head of Wellcome Images, Catherine Draycott.29 The Wellcome has over 40,000 clinical and biomedical images in its online database, alongside over 100,000 photographs of paintings, prints, drawings, manuscripts, rare books and archive material from the Wellcome Library collections. A search for historical images of plastic surgery turns up an album of First World War photographs from King George Military Hospital (later the Red Cross Hospital) in London: pictures that would have served the purposes of BioShock’s art department just as well as those featured in Project Fa de.30 Wellcome images are generally free of charge for study, teaching and academic publication, but commercial use is chargeable and governed by terms and conditions. The Wellcome’s definition of “commercial” is specific and wide-ranging, covering everything from the reproduction of images in medical textbooks to “artist reference” fees for CGI and special effects. If a makeup artist on the BBC hospital drama ARRY-470 supplement Casualty needs to make a gunshot wound look realistic, they can — in the absence of an actual shooting — use the service provided by Wellcome Images.31 Would Wellcome have permitted the developers of BioShock to use their photographs in the game? No, said Draycott, they wouldn’t: even though such a request might fall under the rubric of “artist reference”, it would have been considered unethical. The comparison she made was Benetton asking for images for an advertising campaign “for shock value”. Even if the patient could not be identified, “the usage would still have been unethical”.32 Pending a trans-Atlantic copyright case, where does this leave Henry buy HM61713, BI 1482694 Lumley? Should we conclude that his ghostly presence in BioShock only “deepens the moral grey areas” of the game, to quote one blogger?33 One of the problems with this conclusion is that it fails to address the concerns raised by players in the discussion forum, who point to a troubling interaction — or blurring — of real and imaginary worlds. In contrast to Sicart, who brackets the world outside the game, what disturbs the players (or some of them) is precisely the intrusion of the historical Real. Here is the case against BioShock, from someone whose nom de plume is Nias Wolf: I just feel a little bad that we are using these poor souls (who fought in a war by the way) for entertainment. If I was disfigured horribly, and saw my face being portraid [sic.] as a monster, I would be greatly offended.P H OTO G R AP H I E SA few posts later he (or she) adds: “Honor the dead people. And honor soldiers too. I just want to keep that in mind.”35 One of the genuinely innovative — and truly eerie — things about BioShock is the way it incorporates found objects into the game world. One of these objects is Lumley’s photograph, but the commitment to realism is not confined to the game’s visuals. Each level or “deck” in Rapture has a different theme: the fisheries, the medical deck, arcadia all have distinctive musical and ambient elements: aleatoric music, solo cello and violin, and jazz piano are interspersed with recordings of buoy bells and boats, the distant sound of a concertina, footsteps, a car horn, voices. “I actually found the sound of an insane woman on the internet”, Garry Schyman explained, “and messed with her voice digitally and infused it into the score and it becomes a very scary element”. Sc.Ients or the finer points of copyright law. Curious how a larger organisation might have responded, I contacted the Head of Wellcome Images, Catherine Draycott.29 The Wellcome has over 40,000 clinical and biomedical images in its online database, alongside over 100,000 photographs of paintings, prints, drawings, manuscripts, rare books and archive material from the Wellcome Library collections. A search for historical images of plastic surgery turns up an album of First World War photographs from King George Military Hospital (later the Red Cross Hospital) in London: pictures that would have served the purposes of BioShock’s art department just as well as those featured in Project Fa de.30 Wellcome images are generally free of charge for study, teaching and academic publication, but commercial use is chargeable and governed by terms and conditions. The Wellcome’s definition of “commercial” is specific and wide-ranging, covering everything from the reproduction of images in medical textbooks to “artist reference” fees for CGI and special effects. If a makeup artist on the BBC hospital drama Casualty needs to make a gunshot wound look realistic, they can — in the absence of an actual shooting — use the service provided by Wellcome Images.31 Would Wellcome have permitted the developers of BioShock to use their photographs in the game? No, said Draycott, they wouldn’t: even though such a request might fall under the rubric of “artist reference”, it would have been considered unethical. The comparison she made was Benetton asking for images for an advertising campaign “for shock value”. Even if the patient could not be identified, “the usage would still have been unethical”.32 Pending a trans-Atlantic copyright case, where does this leave Henry Lumley? Should we conclude that his ghostly presence in BioShock only “deepens the moral grey areas” of the game, to quote one blogger?33 One of the problems with this conclusion is that it fails to address the concerns raised by players in the discussion forum, who point to a troubling interaction — or blurring — of real and imaginary worlds. In contrast to Sicart, who brackets the world outside the game, what disturbs the players (or some of them) is precisely the intrusion of the historical Real. Here is the case against BioShock, from someone whose nom de plume is Nias Wolf: I just feel a little bad that we are using these poor souls (who fought in a war by the way) for entertainment. If I was disfigured horribly, and saw my face being portraid [sic.] as a monster, I would be greatly offended.P H OTO G R AP H I E SA few posts later he (or she) adds: “Honor the dead people. And honor soldiers too. I just want to keep that in mind.”35 One of the genuinely innovative — and truly eerie — things about BioShock is the way it incorporates found objects into the game world. One of these objects is Lumley’s photograph, but the commitment to realism is not confined to the game’s visuals. Each level or “deck” in Rapture has a different theme: the fisheries, the medical deck, arcadia all have distinctive musical and ambient elements: aleatoric music, solo cello and violin, and jazz piano are interspersed with recordings of buoy bells and boats, the distant sound of a concertina, footsteps, a car horn, voices. “I actually found the sound of an insane woman on the internet”, Garry Schyman explained, “and messed with her voice digitally and infused it into the score and it becomes a very scary element”. Sc.

Dicative of the connection between the anomalous pattern of communication and

Dicative of the connection between the anomalous pattern of communication and the occurrence of the Lake Kivu earthquakes. doi:10.1371/journal.pone.0120449.gPLOS ONE | DOI:10.1371/journal.pone.0120449 March 25,6 /Spatiotemporal Detection of Unusual Human Population BehaviorFig 3. Sites with unusually low behavior on February 3, 2008. The green cross marks the location of the epicenters of the Lake Kivu earthquakes, while the two green circles mark the 25 and 50 km areas around the epicenters. One site recorded unusually high call volume and movement frequency, and one additional site recorded unusually high call volume. Both sites belong to the same spatial cluster, and are located relatively far from the approximate Belinostat price locations of the earthquakes epicenters. The anomalous pattern of communications at these two sites could be caused by some other event, possibly unrelated with the Lake Kivu earthquakes. doi:10.1371/journal.pone.0120449.gPLOS ONE | DOI:10.1371/journal.pone.0120449 March 25,7 /Spatiotemporal Detection of Unusual Human Population BehaviorFig 4. Call volume for site 361. Calling behavior of the people who made at least one call from at least one cellular tower located in site 361 between January 24, 2008 (10 days before the Lake Kivu earthquakes) and February 13, 2008 (10 days after the Lake Kivu earthquakes). The SP600125 dose side-by-side boxplots represent the distribution of the number of calls made by these people in each of the 21 days. The squares indicate the total number of calls made in site 361 in each of the 21 days. doi:10.1371/journal.pone.0120449.gFig 5. Movement frequency for site 361. Mobility behavior of the people who made at least one call from at least one cellular towers located in site 361 between January 24, 2008 (10 days before the Lake Kivu earthquakes) and February 13, 2008 (10 days after the Lake Kivu earthquakes). The side-by-side boxplots represent the distribution of the movement frequency of these people on each of the 21 days. doi:10.1371/journal.pone.0120449.gPLOS ONE | DOI:10.1371/journal.pone.0120449 March 25,8 /Spatiotemporal Detection of Unusual Human Population Behaviorcompared to before. Thus it is the brief period of time during and just after an emergency event when we expect to find the largest changes in reactionary behaviors, and it is the longer preevent and post-event disaster periods to which we must compare. Second, in addition to emergency events, planned non-emergency events occur often and these can disrupt routine behavioral patterns as well. [15] find dramatic changes in call frequency in response to festivals and concerts, and it is likely that other events, including holidays, will also produce changes. The period of time in which we can expect to find the largest change in reactionary response to a planned event (in contrast to unplanned events) could include the immediate pre-event period, the event itself, and the immediate post-event period. If our goal is to identify emergency events using changes in behavioral patterns, we must also identify, and separate, non-emergency events that could also produce behavioral changes. Third, it is possible that there is more than one emergency or non-emergency event in a single day. Different events could influence people in a small area, in a region, or even across a whole country. An effective event identification system must be able to identify when behavioral patterns suggest a single localized event, multiple localized events, or a single.Dicative of the connection between the anomalous pattern of communication and the occurrence of the Lake Kivu earthquakes. doi:10.1371/journal.pone.0120449.gPLOS ONE | DOI:10.1371/journal.pone.0120449 March 25,6 /Spatiotemporal Detection of Unusual Human Population BehaviorFig 3. Sites with unusually low behavior on February 3, 2008. The green cross marks the location of the epicenters of the Lake Kivu earthquakes, while the two green circles mark the 25 and 50 km areas around the epicenters. One site recorded unusually high call volume and movement frequency, and one additional site recorded unusually high call volume. Both sites belong to the same spatial cluster, and are located relatively far from the approximate locations of the earthquakes epicenters. The anomalous pattern of communications at these two sites could be caused by some other event, possibly unrelated with the Lake Kivu earthquakes. doi:10.1371/journal.pone.0120449.gPLOS ONE | DOI:10.1371/journal.pone.0120449 March 25,7 /Spatiotemporal Detection of Unusual Human Population BehaviorFig 4. Call volume for site 361. Calling behavior of the people who made at least one call from at least one cellular tower located in site 361 between January 24, 2008 (10 days before the Lake Kivu earthquakes) and February 13, 2008 (10 days after the Lake Kivu earthquakes). The side-by-side boxplots represent the distribution of the number of calls made by these people in each of the 21 days. The squares indicate the total number of calls made in site 361 in each of the 21 days. doi:10.1371/journal.pone.0120449.gFig 5. Movement frequency for site 361. Mobility behavior of the people who made at least one call from at least one cellular towers located in site 361 between January 24, 2008 (10 days before the Lake Kivu earthquakes) and February 13, 2008 (10 days after the Lake Kivu earthquakes). The side-by-side boxplots represent the distribution of the movement frequency of these people on each of the 21 days. doi:10.1371/journal.pone.0120449.gPLOS ONE | DOI:10.1371/journal.pone.0120449 March 25,8 /Spatiotemporal Detection of Unusual Human Population Behaviorcompared to before. Thus it is the brief period of time during and just after an emergency event when we expect to find the largest changes in reactionary behaviors, and it is the longer preevent and post-event disaster periods to which we must compare. Second, in addition to emergency events, planned non-emergency events occur often and these can disrupt routine behavioral patterns as well. [15] find dramatic changes in call frequency in response to festivals and concerts, and it is likely that other events, including holidays, will also produce changes. The period of time in which we can expect to find the largest change in reactionary response to a planned event (in contrast to unplanned events) could include the immediate pre-event period, the event itself, and the immediate post-event period. If our goal is to identify emergency events using changes in behavioral patterns, we must also identify, and separate, non-emergency events that could also produce behavioral changes. Third, it is possible that there is more than one emergency or non-emergency event in a single day. Different events could influence people in a small area, in a region, or even across a whole country. An effective event identification system must be able to identify when behavioral patterns suggest a single localized event, multiple localized events, or a single.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ BLU-554 clinical trials predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed L-660711 sodium salt molecular weight predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

Eir effectiveness in achieving objectives. By analysing user behaviours in detail

Eir P144MedChemExpress Disitertide effectiveness in achieving objectives. By analysing user behaviours in detail, in Anlotinib web particular when social media posts were wellreceived, an organization can evaluate the effectiveness of social media content and whether it is in line with its strategic objectives, thus helping to shape future content.CERN’s Social Media PlatformsThis study focused on a sub-set of five of CERN’s social media platforms: Two Twitter accounts (in English and in French); Facebook, Google+ and Instagram (LinkedIn and YouTube were not included because the regularity and content of posts on these platforms does not match the others). Each platform differs in audience numbers and demographics, detailed in Table 2.MethodologyForty-eight (48) different topics, each featuring a unique image (e.g. an illustration or photograph), were (cross-)posted on five of CERN’s social media platforms over eight weeks in 2014 (17 October?11 December). Each topic belonged to one of the following four categories: (1) News, (2) “Guess What It Is” (GWII), which featured mysterious images (e.g. images of unusual scientific instruments), (3) “Throwback Thursday” (TBT), which featured historical images, and (4) “Wow”, featuring awe-inspiring images. Items (i.e., Facebook statuses, Twitter tweets,PLOS ONE | DOI:10.1371/journal.pone.0156409 May 27,5 /Engagement with Particle Physics on CERN’s Social Media PlatformsTable 2. Demographics of the Audience on Each Platform. Data recorded during the data collection period 17 October?11 December 2014. Platform Audience at start of data collection Audience at end of data collection Gender F / M Age 13?7 (F / M ) 1 Age 18?4 (F / M ) 1 Age 25?4 (F / M ) 1 Age 35?4 (F / M ) 1 Age 45?4 (F / M ) 1 Age 55?4 (F / M ) 1 Age 65+ (F / M ) 1 Top 5 countries of originFacebook 343K 367K 31.3 / 68.7 0.9 / 3 3.7 / 11 9.1 / 21.1 8.8 / 17.9 6.5 / 11.9 1.6 / 2.8 0.6 / 1.1 USA, India, UK, Italy, TurkeyTwitter English 1.03M 1.06M 29.9 / 70.1 0.8 / 2.8 4 / 11 7.7 / 21.5 9.4 / 17.8 5.9 / 12.7 1.5 / 3.2 0.6 / 1.1 USA, UK, Italy, Spain, SwitzerlandTwitter French 12.2K 12.6K 41.5 / 58.5 1.3 / 2 5.7 / 8.3 10.6 / 17.8 10.5 / 14.6 9.8 / 11.4 2.7 / 3.2 0.9 / 1.2 France, Switzerland, Canada, Belgium, USAGoogle+ 104K 110K 29 / 71 1 / 2.9 4.8 / 10.7 8.2 / 21.3 7.7 / 18.1 5.2 / 13 1.5 / 3.7 0.6 / 1.3 Ukraine, USA, India, Denmark, UKInstagram 100 1.19K 37.9 / 62.1 1.6 / 2.8 5.9 / 11.8 12.6 / 19.7 10.1 / 14.5 5.8 / 9.6 1.6 / 2.6 0.4 / 1 US, Italy, UK, France, Turkeyof the total percentage of that genderdoi:10.1371/journal.pone.0156409.tetc.) relating to each topic were posted on one or more of these platforms. Example items are provided in Fig 1. In most cases, but not all, topics were cross-posted on all five platforms. In total, this yielded 214 items (Table 3). For all platforms, each item contained either one or two links, yielding 225 links in total. Items on Instagram had inactive links in the text due to the technical constraints of the Instagram platform (nInstagram = 32). To follow a link, a user would have to copy-paste the text into a browser. (Table 4). Users of the respective platforms were either exposed to the items or not exposed to them, depending on their individual usage habits and the technical settings of the particular platform. Facebook, for example, uses an algorithm that filters what the audience sees in their news feed, such that “[o]f the 1,500+ stories a person might see whenever they log onto Facebook, News Feed displays approximately 300″.Eir effectiveness in achieving objectives. By analysing user behaviours in detail, in particular when social media posts were wellreceived, an organization can evaluate the effectiveness of social media content and whether it is in line with its strategic objectives, thus helping to shape future content.CERN’s Social Media PlatformsThis study focused on a sub-set of five of CERN’s social media platforms: Two Twitter accounts (in English and in French); Facebook, Google+ and Instagram (LinkedIn and YouTube were not included because the regularity and content of posts on these platforms does not match the others). Each platform differs in audience numbers and demographics, detailed in Table 2.MethodologyForty-eight (48) different topics, each featuring a unique image (e.g. an illustration or photograph), were (cross-)posted on five of CERN’s social media platforms over eight weeks in 2014 (17 October?11 December). Each topic belonged to one of the following four categories: (1) News, (2) “Guess What It Is” (GWII), which featured mysterious images (e.g. images of unusual scientific instruments), (3) “Throwback Thursday” (TBT), which featured historical images, and (4) “Wow”, featuring awe-inspiring images. Items (i.e., Facebook statuses, Twitter tweets,PLOS ONE | DOI:10.1371/journal.pone.0156409 May 27,5 /Engagement with Particle Physics on CERN’s Social Media PlatformsTable 2. Demographics of the Audience on Each Platform. Data recorded during the data collection period 17 October?11 December 2014. Platform Audience at start of data collection Audience at end of data collection Gender F / M Age 13?7 (F / M ) 1 Age 18?4 (F / M ) 1 Age 25?4 (F / M ) 1 Age 35?4 (F / M ) 1 Age 45?4 (F / M ) 1 Age 55?4 (F / M ) 1 Age 65+ (F / M ) 1 Top 5 countries of originFacebook 343K 367K 31.3 / 68.7 0.9 / 3 3.7 / 11 9.1 / 21.1 8.8 / 17.9 6.5 / 11.9 1.6 / 2.8 0.6 / 1.1 USA, India, UK, Italy, TurkeyTwitter English 1.03M 1.06M 29.9 / 70.1 0.8 / 2.8 4 / 11 7.7 / 21.5 9.4 / 17.8 5.9 / 12.7 1.5 / 3.2 0.6 / 1.1 USA, UK, Italy, Spain, SwitzerlandTwitter French 12.2K 12.6K 41.5 / 58.5 1.3 / 2 5.7 / 8.3 10.6 / 17.8 10.5 / 14.6 9.8 / 11.4 2.7 / 3.2 0.9 / 1.2 France, Switzerland, Canada, Belgium, USAGoogle+ 104K 110K 29 / 71 1 / 2.9 4.8 / 10.7 8.2 / 21.3 7.7 / 18.1 5.2 / 13 1.5 / 3.7 0.6 / 1.3 Ukraine, USA, India, Denmark, UKInstagram 100 1.19K 37.9 / 62.1 1.6 / 2.8 5.9 / 11.8 12.6 / 19.7 10.1 / 14.5 5.8 / 9.6 1.6 / 2.6 0.4 / 1 US, Italy, UK, France, Turkeyof the total percentage of that genderdoi:10.1371/journal.pone.0156409.tetc.) relating to each topic were posted on one or more of these platforms. Example items are provided in Fig 1. In most cases, but not all, topics were cross-posted on all five platforms. In total, this yielded 214 items (Table 3). For all platforms, each item contained either one or two links, yielding 225 links in total. Items on Instagram had inactive links in the text due to the technical constraints of the Instagram platform (nInstagram = 32). To follow a link, a user would have to copy-paste the text into a browser. (Table 4). Users of the respective platforms were either exposed to the items or not exposed to them, depending on their individual usage habits and the technical settings of the particular platform. Facebook, for example, uses an algorithm that filters what the audience sees in their news feed, such that “[o]f the 1,500+ stories a person might see whenever they log onto Facebook, News Feed displays approximately 300″.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. SC144 web Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for Lurbinectedin site adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which LY-2523355MedChemExpress Litronesib information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach BMS-214662 site activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres Isovaleryl-Val-Val-Sta-Ala-Sta-OH solubility should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Hexanoyl-Tyr-Ile-Ahx-NH2MedChemExpress Dihexa Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass Mirogabalin custom synthesis settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – Naramycin A site though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global GLPG0187 biological activity Health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The Pedalitin permethyl ether site people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation Doravirine web strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The order EPZ004777 remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Aul M. Peterson / PhytoKeys 15: 1?04 (2012)2950?300 m (see below, Correll’s estimation is

Aul M. Peterson / PhytoKeys 15: 1?04 (2012)2950?300 m (see below, Correll’s estimation is too high according to the geodetic mark at the top of the peak). Flowering August to October. Specimens examined. Mexico. Chihuahua: Sierra Mohinora, near Cumbre Mohinora, 25?7’34″N, 107?3’49″W, 3250-3300 m, 13 Sep 2006, P.M.Peterson 20048, F.S chez-Alvarado E.P.G ez-Ru (US); ditto, 20049 (US); ditto, on summit, 10,000?2,000 ft [3050-3660 m], 16-17 Oct 1959, D.S.Correll 23177 H.S.Gentry (LL). Discussion. When the second author FPS-ZM1 dose visited the type locality in 2006, the habitat within 5 km of the peak was found to be quite disturbed by grazing and logging. The holotype was initially determined as Poa tracyi “vel. aff.” by J.R C.G. Reeder in 1989).12. Poa mulleri Swallen, J. Wash. Acad. Sci. 30(5): 211. 1940. http://species-id.net/wiki/Poa_mulleri Figs 12, 13 A-D Type: Mexico, Nuevo Le , Municipio de Galeana, collected in pine woods on the Peak of Cerro Potos? 21 Jul 1935, C.H. Meuller 2251 (holotype: US-1645320!; isotypes: GH!, US-1646008!). Description. Hermaphroditic. Perennials; tufted, tufts dense, fairly small and low (mostly 6?0 cm tall), pale green, to slightly bluish-grey-green; tillers intravaginal (each subtended by a single elongated, 2-keeled, longitudinally split prophyll), and extravaginal (basally cataphyllous), without lateral or downward tending, cataphyllous shoots, sterile shoots more numerous than flowering shoots. Culms 9?8(?2) cm tall, erect to loosely ascending, sometimes decumbent or geniculate, terete, smooth; nodes 2?, upper 0?(?) exerted, uppermost at mid-culm. Leaves mostly basal; leaf sheaths slightly keeled, smooth, glabrous; butt sheaths papery or becoming slightly fibrous in age, smooth glabrous; flag leaf sheaths 4?(?1) cm long, margins fused 13?5 their length, sheath ca. 2? ?longer than its blade; collars smooth, glabrous; ligules 0.25?.8 mm long, abaxially minutely scabrous, upper margin irregular, minutely scabrous; apex truncate, sterile shoot ligules like those of the culm leaves; blades to 8(?2) cm long, 1? mm wide, involute, margins inrolling, soft, Nutlin-3a chiralMedChemExpress Nutlin-3a chiral moderately thick, abaxially smooth, papilliate, veins slightly expressed, margins scabrous, adaxially papilliate, slightly scabrous over the costae, apex prow-tipped; culm blades more or less equal in length or the middle ones longest, flag leaf blades 0.9?.5 cm long; sterile shoot blades like those of the culm blades. Panicles 3.4? cm long, erect, open, pyramidal, exerted, fairly sparse, with 20?0 spikelet, peduncles and axis smooth or sparsely scabrous, proximal internode 0.7? cm long; rachis with branches (1?2 per node; primary branches widely spreading to reflexed, slightly flexuous, weakly to distinctly angled, moderately to densely scabrous, hooks mostly on the angles, minutely papilliate; lateral pedicels mostly 1/5?/2 the spikelet in length, sparsely to moderately coarse scabrous, densely papilliate; longest branches 1.4?.8 cm, with 3? spikelets somewhat clustered, in theRevision of Poa L. (Poaceae, Pooideae, Poeae, Poinae) in Mexico: …Figure 12. Poa mulleri Swallen. Photo of holotype collection (Mueller 2251).Robert J. Soreng Paul M. Peterson / PhytoKeys 15: 1?04 (2012)Figure 13. A Poa mulleri Swallen A spikelet B floret C palea D pistil E Poa seleri Pilg. E spikelet F floret G palea H pistil I Poa scaberula Hook.f. I spikelet J floret K palea L pistil M Poa orizabensis Hitchc. M spikelet N floret O palea P Poa ruprechtii Peyr. P spikelet Q fl.Aul M. Peterson / PhytoKeys 15: 1?04 (2012)2950?300 m (see below, Correll’s estimation is too high according to the geodetic mark at the top of the peak). Flowering August to October. Specimens examined. Mexico. Chihuahua: Sierra Mohinora, near Cumbre Mohinora, 25?7’34″N, 107?3’49″W, 3250-3300 m, 13 Sep 2006, P.M.Peterson 20048, F.S chez-Alvarado E.P.G ez-Ru (US); ditto, 20049 (US); ditto, on summit, 10,000?2,000 ft [3050-3660 m], 16-17 Oct 1959, D.S.Correll 23177 H.S.Gentry (LL). Discussion. When the second author visited the type locality in 2006, the habitat within 5 km of the peak was found to be quite disturbed by grazing and logging. The holotype was initially determined as Poa tracyi “vel. aff.” by J.R C.G. Reeder in 1989).12. Poa mulleri Swallen, J. Wash. Acad. Sci. 30(5): 211. 1940. http://species-id.net/wiki/Poa_mulleri Figs 12, 13 A-D Type: Mexico, Nuevo Le , Municipio de Galeana, collected in pine woods on the Peak of Cerro Potos? 21 Jul 1935, C.H. Meuller 2251 (holotype: US-1645320!; isotypes: GH!, US-1646008!). Description. Hermaphroditic. Perennials; tufted, tufts dense, fairly small and low (mostly 6?0 cm tall), pale green, to slightly bluish-grey-green; tillers intravaginal (each subtended by a single elongated, 2-keeled, longitudinally split prophyll), and extravaginal (basally cataphyllous), without lateral or downward tending, cataphyllous shoots, sterile shoots more numerous than flowering shoots. Culms 9?8(?2) cm tall, erect to loosely ascending, sometimes decumbent or geniculate, terete, smooth; nodes 2?, upper 0?(?) exerted, uppermost at mid-culm. Leaves mostly basal; leaf sheaths slightly keeled, smooth, glabrous; butt sheaths papery or becoming slightly fibrous in age, smooth glabrous; flag leaf sheaths 4?(?1) cm long, margins fused 13?5 their length, sheath ca. 2? ?longer than its blade; collars smooth, glabrous; ligules 0.25?.8 mm long, abaxially minutely scabrous, upper margin irregular, minutely scabrous; apex truncate, sterile shoot ligules like those of the culm leaves; blades to 8(?2) cm long, 1? mm wide, involute, margins inrolling, soft, moderately thick, abaxially smooth, papilliate, veins slightly expressed, margins scabrous, adaxially papilliate, slightly scabrous over the costae, apex prow-tipped; culm blades more or less equal in length or the middle ones longest, flag leaf blades 0.9?.5 cm long; sterile shoot blades like those of the culm blades. Panicles 3.4? cm long, erect, open, pyramidal, exerted, fairly sparse, with 20?0 spikelet, peduncles and axis smooth or sparsely scabrous, proximal internode 0.7? cm long; rachis with branches (1?2 per node; primary branches widely spreading to reflexed, slightly flexuous, weakly to distinctly angled, moderately to densely scabrous, hooks mostly on the angles, minutely papilliate; lateral pedicels mostly 1/5?/2 the spikelet in length, sparsely to moderately coarse scabrous, densely papilliate; longest branches 1.4?.8 cm, with 3? spikelets somewhat clustered, in theRevision of Poa L. (Poaceae, Pooideae, Poeae, Poinae) in Mexico: …Figure 12. Poa mulleri Swallen. Photo of holotype collection (Mueller 2251).Robert J. Soreng Paul M. Peterson / PhytoKeys 15: 1?04 (2012)Figure 13. A Poa mulleri Swallen A spikelet B floret C palea D pistil E Poa seleri Pilg. E spikelet F floret G palea H pistil I Poa scaberula Hook.f. I spikelet J floret K palea L pistil M Poa orizabensis Hitchc. M spikelet N floret O palea P Poa ruprechtii Peyr. P spikelet Q fl.

S. For example, the past studies by Gianaros et al. (2008) and

S. For example, the past studies by Gianaros et al. (2008) and Muscatell et al. (2012) both examined how L-660711 sodium salt web status influenced amygdala reactivity to external images of threatening facial expressions that were largely context-free, whereas in this study we created a more personal threat experience by using an elaborate cover story that provided context for the evaluative words. Given that the amygdala is hypothesized to be important for the detection of emotion and salience in the environment, but not sufficient for the generation of emotional `feelings’ (Wager et al., 2008), it is possible that the use of an emotion-generation task (compared to an emotion-detection task) contributed to the differences in findings between the present investigation and past work in this area. Another possibility is that threatening faces may be more salient than written words, and thus may lead to greater amygdala activation (Adolphs, 2010; Cunningham and Brosch, 2012). Much more research is needed to fully specify the precise neural underpinnings of reactivity to different types of social threats, and how social status may affect these responses. The present finding that social status is AZD0156MedChemExpress AZD0156 related to inflammatory responses to stress replicates two prior studies showingthat individuals lower in subjective social status have a greater stressor-evoked increase in IL-6 (Brydon et al., 2004; Derry et al., 2013). Importantly, while the stress tasks used in these previous experiments involved both cognitive effort and some degree of social evaluation, the stressor used in this study isolated the social evaluative component. Therefore, it appears that the effects of status on inflammatory responses to stress are not simply due to performing a cognitively demanding task on which lower status individuals may perform more poorly (Noble et al., 2007). Rather, it may be that the social-evaluative component of the previously used stress tasks drives the observed increases in inflammation, as lower-status individuals are more sensitive to social cues in the environment (Kraus and Keltner, 2009) and may thus be especially sensitive to the effects of social stress. Future studies could directly test this possibility by assigning participants to complete either a social or a cognitive stressor and examining how social status influences inflammatory responses to these two different tasks. It should also be noted that in this study, social status was associated with stressor-evoked increases in IL-6, but not TNFa, another pro-inflammatory cytokine often studied in the context of stress research (Steptoe et al., 2007). It is possible that a restricted range or floor effect in TNF-a responses may have limited our ability to detect associations between social status and this inflammatory marker, as the overall group did not show changes in TNF-a after exposure to the stressor (Muscatell et al., 2015). It will be important for future studies to clarify the potential specificity in the relation between social status and measures of inflammatory activity. Interestingly, while the neural and inflammatory data suggest that individuals reporting lower status may be more reactive to a social stressor, a very different pattern emerged when examining how social status was related to affective responses to the stressor. Specifically, higher subjective status individuals reported greater increases in negative feelings from pre- to poststress, compared with lower subjective status individuals.S. For example, the past studies by Gianaros et al. (2008) and Muscatell et al. (2012) both examined how status influenced amygdala reactivity to external images of threatening facial expressions that were largely context-free, whereas in this study we created a more personal threat experience by using an elaborate cover story that provided context for the evaluative words. Given that the amygdala is hypothesized to be important for the detection of emotion and salience in the environment, but not sufficient for the generation of emotional `feelings’ (Wager et al., 2008), it is possible that the use of an emotion-generation task (compared to an emotion-detection task) contributed to the differences in findings between the present investigation and past work in this area. Another possibility is that threatening faces may be more salient than written words, and thus may lead to greater amygdala activation (Adolphs, 2010; Cunningham and Brosch, 2012). Much more research is needed to fully specify the precise neural underpinnings of reactivity to different types of social threats, and how social status may affect these responses. The present finding that social status is related to inflammatory responses to stress replicates two prior studies showingthat individuals lower in subjective social status have a greater stressor-evoked increase in IL-6 (Brydon et al., 2004; Derry et al., 2013). Importantly, while the stress tasks used in these previous experiments involved both cognitive effort and some degree of social evaluation, the stressor used in this study isolated the social evaluative component. Therefore, it appears that the effects of status on inflammatory responses to stress are not simply due to performing a cognitively demanding task on which lower status individuals may perform more poorly (Noble et al., 2007). Rather, it may be that the social-evaluative component of the previously used stress tasks drives the observed increases in inflammation, as lower-status individuals are more sensitive to social cues in the environment (Kraus and Keltner, 2009) and may thus be especially sensitive to the effects of social stress. Future studies could directly test this possibility by assigning participants to complete either a social or a cognitive stressor and examining how social status influences inflammatory responses to these two different tasks. It should also be noted that in this study, social status was associated with stressor-evoked increases in IL-6, but not TNFa, another pro-inflammatory cytokine often studied in the context of stress research (Steptoe et al., 2007). It is possible that a restricted range or floor effect in TNF-a responses may have limited our ability to detect associations between social status and this inflammatory marker, as the overall group did not show changes in TNF-a after exposure to the stressor (Muscatell et al., 2015). It will be important for future studies to clarify the potential specificity in the relation between social status and measures of inflammatory activity. Interestingly, while the neural and inflammatory data suggest that individuals reporting lower status may be more reactive to a social stressor, a very different pattern emerged when examining how social status was related to affective responses to the stressor. Specifically, higher subjective status individuals reported greater increases in negative feelings from pre- to poststress, compared with lower subjective status individuals.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As Losmapimod cost depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Aprotinin biological activity Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

S relating to commercial sex. In a safe environment, the dialogue

S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship Lixisenatide cost building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the Isoarnebin 4 chemical information programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.S relating to commercial sex. In a safe environment, the dialogue usually happened in such a natural and friendly sisterhood way, that it dispelled women’s fear of seeing a doctor for STIs, and made the sex topics easier to talk about. They would also chat about the new changes of the sex industry, through which information would be collected on where new FSW were appearing, whether there was drug use in the venue, which venue was cracked down, etc. We also observed that calls came in quite often to consult for health issues, especially about pregnancy and abortion, or asking for help to refer to other hospitals if the service is out of the range of this clinic. (Field notes, end of 1st week, January 2012) These supportive clinical services, which incorporated respect, concern and relationship building, were essential parts of JZ’s success in working with FSW and surpass the services that would typically be provided to a patient (FSW or otherwise) in a standard clinical setting. Supportive services were especially important for attracting FSWs who were hard to reach through traditional outreach work, such as street-standing FSWs and women who were very mobile. For example, many migrant FSWs now come to the centre to get tested before returning to their hometowns for holidays. As noted by one FSW: I’ve known Dr Z for 4? years; she is a good and skilled person, we believe in her. ?I have a child and husband at home and I’ll visit them soon ?very exciting ?I usually go home once or twice a year and definitely don’t want to transmit to my family some disease, you know, in this business, it is hard to tell ?I don’t feel like I have a problem, but just to double check, to be safe and feel more comfortable. (FSW, in early 40s) A welcoming clinic setting and high-quality clinical services were both essential elements of JZ’s success; neither component alone would be as successful at attracting and maintaining FSW’s engagement with the programme services. Responsive outreach work with FSW–Outreach work consisted of on-site training to FSW about STI and HIV knowledge and strategies of how to avoid violence from clients and police, distribution of IEC materials, on-site health consultations and collection of blood for STI tests, visitation of incarcerated FSW and additional supportive activities. JZ’s regular outreach work happens at least three times a week. The outreach activities are conducted by pairs of workers (either one peer leader trained FSW and one CBO worker or two CBO workers if no peer leaders are available) and generally involve walking the neighbourhoods to visit sex work venues one by one. For remote areas, staff take a taxi or bus, or sometimes used their own cars. All staff and management participated in outreach work. This comprehensive participation familiarised staff with the local FSWs’ work situations ?including venue organisation types ?which in turn benefited their intervention work. Outreach services covered different types of sex work venues from streets to large karaoke bars. The sites and content of the outreach services vary depending on the occupational issues arising during the current time period, JZ’s relationship with the venues and the business situation of each site. As outreach coordinator Miss Chen described:Author Manuscript Author Manuscript Author Manuscript Author ManuscriptGlob Public Health. Author manuscript; available in PMC 2016 August 01.Huang et al.PageYou can’t expect people to warmly welcome yo.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in Leupeptin (hemisulfate) site literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to GS-5816 site retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of RR6 manufacturer sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.get MG516 0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

T risk for numerous neglected tropical diseases such chagas disease, filariasis

T risk for numerous neglected tropical diseases such chagas disease, filariasis, and schistosomiasis [46?8]. Results of our informative in-depth, CBR-5884 site qualitative investigation of schistosomiasis among school-aged children suggested that despite previous initiatives related to urogenital schistosomiasis control and prevention in Zanzibar [29,44,49], people’s knowledge about disease symptoms, transmission, and prevention were poor. Our findings identified several barriers to optimal disease prevention and control. First, we observed that school-aged children regularly exposed themselves to contaminated natural, open freshwater bodies through recreational and domestic activities of daily living with little knowledge about routes of schistosomiasis transmission, which is in line with findings from previous studies in Zanzibar, Cyclosporine site Tanzania, Zimbabwe, and Western Kenya [50?2]. Second, S. haematobium infection was often viewed as an infection with an intestinal worm of little significance, not typically associated with severe health consequences, and little to no disease stigma. This is in contrast to reports from previous research in Nigeria, where individuals with schistosomiasis disease were stigmatized by others [53]. The Health Belief Model posits that perceived seriousness along with perceived susceptibility, perceived benefits, and perceived barriers are critical constructs used to explain and influence changes in health behaviors [54,55]. It also specifies that if individuals perceive a negative health outcome to be severe and perceive themselves to be susceptible to those negative outcomes, they are more likely to adopt positive protective behaviors [17,54,55]. Drawing upon the constructs of this behavioral theory supports shifting the context of schistosomiasis to that of a blood fluke, with serious health consequences such as bladder cancer and infertility, rather than the current perception of a less severe “worm.” Elaborating on the perceived seriousness of the infection, whether through medical information or increased awareness of the serious effects of the disease on a person’s life, is critical to address in a behavioral intervention [17,54,56]. There is evidence that theorybased, behavioral interventions can increase effectiveness among a variety of public health issues [57?0]. Synthesis of behavioral intervention research and non-regulatory interventions most often advocates the application of behavioral theory as an integral step in intervention design and evaluation [55,61]. Third, many people described abdominal pain, blood in the urine (hematuria), pain or burning during urination (dysuria), and commonly genital itching as symptoms of infection. However, as observed in studies conducted elsewhere in sub-Saharan Africa [62], these symptoms were also perceived as sexually transmitted infections that indeed may appear similar to symptoms of urogenital schistosomiasis. A person with a sexually transmitted infection may bePLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.July 11,12 /Community Perceptions about Schistosomiasis in Zanzibarreluctant to seek treatment due to shame and stigma [53,62]. Therefore, correcting the misperception that schistosomiasis is a sexually transmitted disease, while at the same time supporting the need to seek treatment for any and all similar symptoms, could be an important component of a schistosomiasis educational campaign to improve treatment seeking. Fourth, first line treatment for a fe.T risk for numerous neglected tropical diseases such chagas disease, filariasis, and schistosomiasis [46?8]. Results of our informative in-depth, qualitative investigation of schistosomiasis among school-aged children suggested that despite previous initiatives related to urogenital schistosomiasis control and prevention in Zanzibar [29,44,49], people’s knowledge about disease symptoms, transmission, and prevention were poor. Our findings identified several barriers to optimal disease prevention and control. First, we observed that school-aged children regularly exposed themselves to contaminated natural, open freshwater bodies through recreational and domestic activities of daily living with little knowledge about routes of schistosomiasis transmission, which is in line with findings from previous studies in Zanzibar, Tanzania, Zimbabwe, and Western Kenya [50?2]. Second, S. haematobium infection was often viewed as an infection with an intestinal worm of little significance, not typically associated with severe health consequences, and little to no disease stigma. This is in contrast to reports from previous research in Nigeria, where individuals with schistosomiasis disease were stigmatized by others [53]. The Health Belief Model posits that perceived seriousness along with perceived susceptibility, perceived benefits, and perceived barriers are critical constructs used to explain and influence changes in health behaviors [54,55]. It also specifies that if individuals perceive a negative health outcome to be severe and perceive themselves to be susceptible to those negative outcomes, they are more likely to adopt positive protective behaviors [17,54,55]. Drawing upon the constructs of this behavioral theory supports shifting the context of schistosomiasis to that of a blood fluke, with serious health consequences such as bladder cancer and infertility, rather than the current perception of a less severe “worm.” Elaborating on the perceived seriousness of the infection, whether through medical information or increased awareness of the serious effects of the disease on a person’s life, is critical to address in a behavioral intervention [17,54,56]. There is evidence that theorybased, behavioral interventions can increase effectiveness among a variety of public health issues [57?0]. Synthesis of behavioral intervention research and non-regulatory interventions most often advocates the application of behavioral theory as an integral step in intervention design and evaluation [55,61]. Third, many people described abdominal pain, blood in the urine (hematuria), pain or burning during urination (dysuria), and commonly genital itching as symptoms of infection. However, as observed in studies conducted elsewhere in sub-Saharan Africa [62], these symptoms were also perceived as sexually transmitted infections that indeed may appear similar to symptoms of urogenital schistosomiasis. A person with a sexually transmitted infection may bePLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.July 11,12 /Community Perceptions about Schistosomiasis in Zanzibarreluctant to seek treatment due to shame and stigma [53,62]. Therefore, correcting the misperception that schistosomiasis is a sexually transmitted disease, while at the same time supporting the need to seek treatment for any and all similar symptoms, could be an important component of a schistosomiasis educational campaign to improve treatment seeking. Fourth, first line treatment for a fe.

Ions resulting mainly from familial or social conflicts and did not

Ions resulting mainly from familial or social conflicts and did not have a notion of the biopsychological facts. Thus, the Turkish patient group rarely considered professional treatment (e.g., psychotherapy, psychotropic drugs, psycho-education) as a valuable tool for recovery. Instead, the source for recovery was seen in the regaining of social harmony within the family and social environment. Not surprisingly, it has been reported that Turkish immigrant women in Amsterdam consulted social work facilities and women’s crisis intervention centers nearly 1.5 times more than mental health care services (116). As Kirmayer and Sartorius (117) also noted, these results suggest that those patients are not only seeking mitigation of symptoms but also individually and socially meaningful explanations and psychosocial treatments for their illness.mentioned positive AG-221 mechanism of action consequences of expressive suppression in Turkish women were owing to their additional use of cognitive reappraisal. This finding can lead to the conclusion that what relates to a poor mental health is not the presence of suppression per se, but rather the absence of cognitive reappraisal or the rigid and exclusive use of suppression. Hence, rather than discouraging suppression, promoting a more flexible use of emotion regulation strategies (e.g., additional use of adaptive emotion regulation strategies) in psychotherapy seems more fitting for the needs of this patient group. Therapists AKB-6548MedChemExpress Vadadustat should be aware that Turkish patients might benefit from expressive suppression to avoid social or familial conflicts-which are frequently reported as causes of their mental distress. As already mentioned, most Turkish patients conceptualize depression as a social problem or an emotional reaction to situations resulting from a disruption in social/familial relationships. Unlike patients with Western origins, they did not have a notion of biopsychological causes. Therefore, instead of professional treatment, these patients’ suggestions for management and health-seeking emphasized self-management and social support. This highlights the importance of psychosocial treatment for this particular clientele. As noted before, without ameliorating familial or social conflicts, working mainly on personal conflicts or using medication alone would probably fail to achieve the desired treatment outcomes. Accordingly, given these patients’ group and family orientations, acknowledgement and inclusion of family members in the psychotherapy process (e.g., assessment and therapeutic goals/decisions) might bring better outcomes. For instance, there is some evidence that such biopsychosocial holistic approaches work quite successfully with patients from collectivistic non-Western cultures (e.g., Egypt) (123). A similar recommendation also came from some practitioners working with Turkish patients in Germany. Erim and Mustard (124) highlighted the importance of extending classical Western individualistic treatment approaches with collectivist principles. This could be, for instance, on the one hand working with interpersonal conflicts and the involvement of family members in the therapy; on the other hand, encouraging patients’ individuation and social relationships (e.g., through participation in regular activities in clubs or language courses) to promote their integration and, hence, their mental health. Despite the higher prevalence rates of mental disorders among Turkish patients, the literature points to low service uti.Ions resulting mainly from familial or social conflicts and did not have a notion of the biopsychological facts. Thus, the Turkish patient group rarely considered professional treatment (e.g., psychotherapy, psychotropic drugs, psycho-education) as a valuable tool for recovery. Instead, the source for recovery was seen in the regaining of social harmony within the family and social environment. Not surprisingly, it has been reported that Turkish immigrant women in Amsterdam consulted social work facilities and women’s crisis intervention centers nearly 1.5 times more than mental health care services (116). As Kirmayer and Sartorius (117) also noted, these results suggest that those patients are not only seeking mitigation of symptoms but also individually and socially meaningful explanations and psychosocial treatments for their illness.mentioned positive consequences of expressive suppression in Turkish women were owing to their additional use of cognitive reappraisal. This finding can lead to the conclusion that what relates to a poor mental health is not the presence of suppression per se, but rather the absence of cognitive reappraisal or the rigid and exclusive use of suppression. Hence, rather than discouraging suppression, promoting a more flexible use of emotion regulation strategies (e.g., additional use of adaptive emotion regulation strategies) in psychotherapy seems more fitting for the needs of this patient group. Therapists should be aware that Turkish patients might benefit from expressive suppression to avoid social or familial conflicts-which are frequently reported as causes of their mental distress. As already mentioned, most Turkish patients conceptualize depression as a social problem or an emotional reaction to situations resulting from a disruption in social/familial relationships. Unlike patients with Western origins, they did not have a notion of biopsychological causes. Therefore, instead of professional treatment, these patients’ suggestions for management and health-seeking emphasized self-management and social support. This highlights the importance of psychosocial treatment for this particular clientele. As noted before, without ameliorating familial or social conflicts, working mainly on personal conflicts or using medication alone would probably fail to achieve the desired treatment outcomes. Accordingly, given these patients’ group and family orientations, acknowledgement and inclusion of family members in the psychotherapy process (e.g., assessment and therapeutic goals/decisions) might bring better outcomes. For instance, there is some evidence that such biopsychosocial holistic approaches work quite successfully with patients from collectivistic non-Western cultures (e.g., Egypt) (123). A similar recommendation also came from some practitioners working with Turkish patients in Germany. Erim and Mustard (124) highlighted the importance of extending classical Western individualistic treatment approaches with collectivist principles. This could be, for instance, on the one hand working with interpersonal conflicts and the involvement of family members in the therapy; on the other hand, encouraging patients’ individuation and social relationships (e.g., through participation in regular activities in clubs or language courses) to promote their integration and, hence, their mental health. Despite the higher prevalence rates of mental disorders among Turkish patients, the literature points to low service uti.

Exacerbated inflammation, but does not alter atherosclerosis.Author ContributionsConceived and designed

Exacerbated inflammation, but does not alter atherosclerosis.Author ContributionsConceived and designed the experiments: SNV KEB. Performed the experiments: SNV FK SB. Analyzed the data: SNV JEK KEB. Contributed reagents/materials/analysis tools: RMB KIA. Wrote the paper: SNV JEK KEB.
For more than a decade after the fall of the Soviet Union, many Eastern European RG7666 cost countries struggled with social and political instability. Consider Bulgaria, a country that changed its entire political system in 1989. The term anomie was used to describe the state of society in Bulgaria that emerged after the economy had collapsed and the political system struggled to respond [1, 2]. Anomie has also been used to describe the state of society in countries undergoing massive structural change (e.g., Iran, see [3, 4]), countries that face major social or economic crises [5], countries with a long history of war (e.g., Yugoslavia, Iraq, Afghanistan, see [6, 7]), or societies that face civil unrest (e.g., South Africa, [8]). Anomie has even been used to describe social contexts with relative prosperity, but where income inequality has eroded social capital and trust (e.g., the U.S., [9, 10, 11]), or where rapid economic growth has created instability and unrest (e.g., China, [12]). Despite the fact that anomie is a common experience that many people and societies in the world today share, to date there is no uniform conceptualization and operationalization of this construct. In this paper, we first review the previous conceptualizations and operationalizations of anomie and highlight their shortcomings. Starting from an operationalization of anomie as a perception of the state of society, we develop a scale that disentangles anomie as a state of society from its outcomes at the individual level. In this way, we equip the field with a tool that can be used to develop better insights into the nature of anomie and the experience of those who live in a state of anomie.Anomie: The Concept and its MeasurementEven though anomie has been conceptualized in different ways, perhaps the most well-known approach is to define anomie as a state of society [9?1, 13]. Durkheim [13] proposed that anomie involves the breakdown of social regulation and the rise of moral disruption. Merton [9, 10] extended this thinking and proposed that anomie emerges from the discrepancy between the cultural aspirations of people within a society and the legitimate means available to those people to achieve them. Still focusing on the state of society, Messner and Rosenfeld [11] took a slightly different approach to Merton and BMS-986020 site focused instead on anomie as a cultural obsession with economic success, manifesting itself as a set of cultural values associated with individualism, achievement orientation, and fetishism of money. Departing somewhat from this well-known work, some have defined anomie as a state of mind. Scholars in this tradition have focused on anomie as an individual’s sense of self-toother alienation or distance [14], or as a set of beliefs, feelings and attitudes in the individual’s mind [15, 16]. In general, these approaches to anomie revolve around a psychological state that can be characterized as a tendency to be self-interested [17], to reject social norms [18, 19], or to feel estranged or isolated from society [14, 20, 21]. In this conceptualization, anomie may also include a sense that life is meaningless [21, 22], where feelings of purposelessness or powerlessness dominate (f.Exacerbated inflammation, but does not alter atherosclerosis.Author ContributionsConceived and designed the experiments: SNV KEB. Performed the experiments: SNV FK SB. Analyzed the data: SNV JEK KEB. Contributed reagents/materials/analysis tools: RMB KIA. Wrote the paper: SNV JEK KEB.
For more than a decade after the fall of the Soviet Union, many Eastern European countries struggled with social and political instability. Consider Bulgaria, a country that changed its entire political system in 1989. The term anomie was used to describe the state of society in Bulgaria that emerged after the economy had collapsed and the political system struggled to respond [1, 2]. Anomie has also been used to describe the state of society in countries undergoing massive structural change (e.g., Iran, see [3, 4]), countries that face major social or economic crises [5], countries with a long history of war (e.g., Yugoslavia, Iraq, Afghanistan, see [6, 7]), or societies that face civil unrest (e.g., South Africa, [8]). Anomie has even been used to describe social contexts with relative prosperity, but where income inequality has eroded social capital and trust (e.g., the U.S., [9, 10, 11]), or where rapid economic growth has created instability and unrest (e.g., China, [12]). Despite the fact that anomie is a common experience that many people and societies in the world today share, to date there is no uniform conceptualization and operationalization of this construct. In this paper, we first review the previous conceptualizations and operationalizations of anomie and highlight their shortcomings. Starting from an operationalization of anomie as a perception of the state of society, we develop a scale that disentangles anomie as a state of society from its outcomes at the individual level. In this way, we equip the field with a tool that can be used to develop better insights into the nature of anomie and the experience of those who live in a state of anomie.Anomie: The Concept and its MeasurementEven though anomie has been conceptualized in different ways, perhaps the most well-known approach is to define anomie as a state of society [9?1, 13]. Durkheim [13] proposed that anomie involves the breakdown of social regulation and the rise of moral disruption. Merton [9, 10] extended this thinking and proposed that anomie emerges from the discrepancy between the cultural aspirations of people within a society and the legitimate means available to those people to achieve them. Still focusing on the state of society, Messner and Rosenfeld [11] took a slightly different approach to Merton and focused instead on anomie as a cultural obsession with economic success, manifesting itself as a set of cultural values associated with individualism, achievement orientation, and fetishism of money. Departing somewhat from this well-known work, some have defined anomie as a state of mind. Scholars in this tradition have focused on anomie as an individual’s sense of self-toother alienation or distance [14], or as a set of beliefs, feelings and attitudes in the individual’s mind [15, 16]. In general, these approaches to anomie revolve around a psychological state that can be characterized as a tendency to be self-interested [17], to reject social norms [18, 19], or to feel estranged or isolated from society [14, 20, 21]. In this conceptualization, anomie may also include a sense that life is meaningless [21, 22], where feelings of purposelessness or powerlessness dominate (f.

Vesela Encheva,2 Ilaria Gori,3 Rebecca E. Saunders,3 Rachael Instrell,3 Ozan Aygun

Vesela Encheva,2 Ilaria Gori,3 Rebecca E. Saunders,3 Rachael Instrell,3 Ozan Aygun,1,7 Marta Rodriguez-Martinez,1 Juston C. Weems,4 Gavin P. Kelly,5 Joan W. Conaway,4,6 Ronald C. Conaway,4,6 Aengus Stewart,5 Michael Howell,3 Ambrosius P. Snijders,2 and Jesper Q. Svejstrup1,*of Transcription Laboratory, the Francis Crick Institute, Clare Hall Laboratories, South Mimms EN6 3LD, UK Analysis and Proteomics Laboratory, the Francis Crick Institute, Clare Hall Laboratories, South Mimms EN6 3LD, UK 3High Throughput Screening Laboratory, the Francis Crick Institute, 44 Lincoln’s Inn Fields, London WC2A 3LY, UK 4Stowers Institute for Medical Research, Kansas City, MO 64110, USA 5Bioinformatics and Biostatistics Laboratory, the Francis Crick Institute, 44 Lincoln’s Inn Fields, London WC2A 3LY, UK 6Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, KS 66160, USA 7Present address: Department of Chemistry, Massachusetts Institute of Technology, Cambridge, MA 02139, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.celrep.2016.04.2Protein 1MechanismsSUMMARYIn order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and Basmisanil site complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanomaassociated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.INTRODUCTION The cellular response to bulky DNA lesions, such as those induced by UV irradiation is multi-faceted. The effect of such damage on transcription is particularly complex. Bulky DNA lesions in the transcribed strand cause stalling of RNA polymerase II (RNAPII), resulting in a block to transcript elongation. Damagestalled RNAPII then functions as a molecular beacon that triggers transcription-coupled MK-5172 msds nucleotide excision repair (TC-NER), the process whereby DNA damage in the transcribed strand of active genes is preferentially removed (Gaillard and Aguilera, 2013). On the other hand, if the DNA lesion for some reason cannot be removed by TC-NER, a mechanism of last resort en-sures that RNAPII is ubiquitylated and degraded by the proteasome, enabling repair by other mechanisms (Wilson et al., 2013). Importantly, bulky DNA lesions not only block RNAPII progress, but also affect transcription genome-wide so that even un-damaged genes temporarily cease to be expressed (Mayne and Lehmann, 1982; Rockx et al., 2000; Proietti-De-Santis et al., 2006). The mechanisms and factors that underlie TCNER and the more general DNA-damage-induced repression of gene expression are still poorly understood. Cockayne syndrome B protein (CSB, also named ERCC6) plays a key role in both TC-NER and the global transcription response to DNA.Vesela Encheva,2 Ilaria Gori,3 Rebecca E. Saunders,3 Rachael Instrell,3 Ozan Aygun,1,7 Marta Rodriguez-Martinez,1 Juston C. Weems,4 Gavin P. Kelly,5 Joan W. Conaway,4,6 Ronald C. Conaway,4,6 Aengus Stewart,5 Michael Howell,3 Ambrosius P. Snijders,2 and Jesper Q. Svejstrup1,*of Transcription Laboratory, the Francis Crick Institute, Clare Hall Laboratories, South Mimms EN6 3LD, UK Analysis and Proteomics Laboratory, the Francis Crick Institute, Clare Hall Laboratories, South Mimms EN6 3LD, UK 3High Throughput Screening Laboratory, the Francis Crick Institute, 44 Lincoln’s Inn Fields, London WC2A 3LY, UK 4Stowers Institute for Medical Research, Kansas City, MO 64110, USA 5Bioinformatics and Biostatistics Laboratory, the Francis Crick Institute, 44 Lincoln’s Inn Fields, London WC2A 3LY, UK 6Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, KS 66160, USA 7Present address: Department of Chemistry, Massachusetts Institute of Technology, Cambridge, MA 02139, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.celrep.2016.04.2Protein 1MechanismsSUMMARYIn order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanomaassociated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.INTRODUCTION The cellular response to bulky DNA lesions, such as those induced by UV irradiation is multi-faceted. The effect of such damage on transcription is particularly complex. Bulky DNA lesions in the transcribed strand cause stalling of RNA polymerase II (RNAPII), resulting in a block to transcript elongation. Damagestalled RNAPII then functions as a molecular beacon that triggers transcription-coupled nucleotide excision repair (TC-NER), the process whereby DNA damage in the transcribed strand of active genes is preferentially removed (Gaillard and Aguilera, 2013). On the other hand, if the DNA lesion for some reason cannot be removed by TC-NER, a mechanism of last resort en-sures that RNAPII is ubiquitylated and degraded by the proteasome, enabling repair by other mechanisms (Wilson et al., 2013). Importantly, bulky DNA lesions not only block RNAPII progress, but also affect transcription genome-wide so that even un-damaged genes temporarily cease to be expressed (Mayne and Lehmann, 1982; Rockx et al., 2000; Proietti-De-Santis et al., 2006). The mechanisms and factors that underlie TCNER and the more general DNA-damage-induced repression of gene expression are still poorly understood. Cockayne syndrome B protein (CSB, also named ERCC6) plays a key role in both TC-NER and the global transcription response to DNA.

Ents are over, tends to dissipate naturally with time. We point

Ents are over, tends to dissipate naturally with time. We point out, however, that there is probably also an element of statistical `regression to the mean’ occurring. We did not choose our communities at random: we chose five of them because they were among those with the most extreme sentiment in the autumn period.7 This introduces a bias andNamely: 4 (weddings), 7 (Islam), 9 (Islam versus atheism), 10 (Madeleine McCann) and 11 (religion).1.nursingIsorhamnetin biological activity nursing Scottish politics Islam versus atheism religion Islam0.9 0.8 0.7 conductance 0.6 0.5 0.friends chattingrsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………wildlife and animals dogs astronomy human resources smoking/e-cigarettes housing sector friends chatting weddingsMadeleine McCannIndian politics0.3 0.2 0.1 0 0.`GamerGate’1.0 1.1 1.2 1.3 1.4 1.5 1.6 user loss factor (no. users active in 28-day autumn period divided by number active in later 28-day PD168393MedChemExpress PD168393 spring period) Louvain weighted Louvain k-clique-communities1.Figure 8. Communities with higher conductance tended to lose more of their users over time.1.2 1.0 mean community sentiment based on (SS) 0.8 0.6 0.friends chatting astronomy nursingfriends chattingweddingshousing sector nursingdogshuman resources0.2 0 0.90 ?.2 ?.4 ?.6 ?.wildlife and animalsIndian politics1.1.1.1.`GamerGate’1.religion1.1.1.Scottish politicssmoking/e-cigarettesIslam versus atheism Islam Madeleine McCannuser loss factor (no. users active in 28-day autumn period divided by number active in later 28-day spring period)Figure 9. Communities with more negative sentiment, measured by (SS), tended to lose more of their users over time.makes it more likely for the sentiment in these five communities to become more moderate by the spring period (which it does, in all five cases). This bias is unavoidable when one disproportionately selects communities with extreme sentiment for study. The correlation coefficient in figure 11 is -0.71. The relationship was less apparent using the other sentiment measures, though still present, with corresponding correlations of -0.59 for (SS) and -0.32 for (L).1.2 mean sentiment over 28-day spring period based on (SS)line of equality1.weddingsrsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………0.human resources dogs y = 0.878x + 0.0146 housing sector nursing friends chatting wildlife and animalsfriends chatting0.6 0.4 0.smoking/e-cigarettes religion astronomy Indian politicsnursing0 ?.1 ?.`GamerGate’?.?.0.0.0.0.0.1.Islam versus atheism scottish politics Islam?.?.6 mean sentiment over 28-day autumn period based on (SS) Louvain weighted Louvain k-clique-communitiesFigure 10. Graph showing that community sentiment was very stable over the 19-week period. The solid line shows where the autumn and spring sentiments are equal.0.3 change in sentiment from autumn to spring using (MC)0.Islam versus atheism Islam religion0.Madeleine McCann Scottish politics wildlife and animals human resources dogs nursing smoking/e-cigarettes?.5 ?.0.`GamerGate’1.1.2.2.astronomy friends chatting housing sector?.Indian politicsfriends chattingweddings?.nursing?.4 mean sentiment over 28-day autumn period based on (MC) Louvain weighted Louvain k-clique-communitiesFigure 11. Graph showing that the sentiment in 16 of the 18 communities became more moderate over time. This plot uses the (MC) measure.The robustness of the weekly sentiment measures suggests that only a limited am.Ents are over, tends to dissipate naturally with time. We point out, however, that there is probably also an element of statistical `regression to the mean’ occurring. We did not choose our communities at random: we chose five of them because they were among those with the most extreme sentiment in the autumn period.7 This introduces a bias andNamely: 4 (weddings), 7 (Islam), 9 (Islam versus atheism), 10 (Madeleine McCann) and 11 (religion).1.nursingnursing Scottish politics Islam versus atheism religion Islam0.9 0.8 0.7 conductance 0.6 0.5 0.friends chattingrsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………wildlife and animals dogs astronomy human resources smoking/e-cigarettes housing sector friends chatting weddingsMadeleine McCannIndian politics0.3 0.2 0.1 0 0.`GamerGate’1.0 1.1 1.2 1.3 1.4 1.5 1.6 user loss factor (no. users active in 28-day autumn period divided by number active in later 28-day spring period) Louvain weighted Louvain k-clique-communities1.Figure 8. Communities with higher conductance tended to lose more of their users over time.1.2 1.0 mean community sentiment based on (SS) 0.8 0.6 0.friends chatting astronomy nursingfriends chattingweddingshousing sector nursingdogshuman resources0.2 0 0.90 ?.2 ?.4 ?.6 ?.wildlife and animalsIndian politics1.1.1.1.`GamerGate’1.religion1.1.1.Scottish politicssmoking/e-cigarettesIslam versus atheism Islam Madeleine McCannuser loss factor (no. users active in 28-day autumn period divided by number active in later 28-day spring period)Figure 9. Communities with more negative sentiment, measured by (SS), tended to lose more of their users over time.makes it more likely for the sentiment in these five communities to become more moderate by the spring period (which it does, in all five cases). This bias is unavoidable when one disproportionately selects communities with extreme sentiment for study. The correlation coefficient in figure 11 is -0.71. The relationship was less apparent using the other sentiment measures, though still present, with corresponding correlations of -0.59 for (SS) and -0.32 for (L).1.2 mean sentiment over 28-day spring period based on (SS)line of equality1.weddingsrsos.royalsocietypublishing.org R. Soc. open sci. 3:…………………………………………0.human resources dogs y = 0.878x + 0.0146 housing sector nursing friends chatting wildlife and animalsfriends chatting0.6 0.4 0.smoking/e-cigarettes religion astronomy Indian politicsnursing0 ?.1 ?.`GamerGate’?.?.0.0.0.0.0.1.Islam versus atheism scottish politics Islam?.?.6 mean sentiment over 28-day autumn period based on (SS) Louvain weighted Louvain k-clique-communitiesFigure 10. Graph showing that community sentiment was very stable over the 19-week period. The solid line shows where the autumn and spring sentiments are equal.0.3 change in sentiment from autumn to spring using (MC)0.Islam versus atheism Islam religion0.Madeleine McCann Scottish politics wildlife and animals human resources dogs nursing smoking/e-cigarettes?.5 ?.0.`GamerGate’1.1.2.2.astronomy friends chatting housing sector?.Indian politicsfriends chattingweddings?.nursing?.4 mean sentiment over 28-day autumn period based on (MC) Louvain weighted Louvain k-clique-communitiesFigure 11. Graph showing that the sentiment in 16 of the 18 communities became more moderate over time. This plot uses the (MC) measure.The robustness of the weekly sentiment measures suggests that only a limited am.

Anned start and need of urgent dialysis start. Population n Cause

Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, Mitochondrial division inhibitor 1 dose patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an buy Anlotinib International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.Anned start and need of urgent dialysis start. Population n Cause/s for urgent dialysis start Asymptomatic + biochemistry abnormalities, n ( ) Over imposed acute kidney injury on CKD, n ( ) Hyperkalemia, n ( ) More than one cause at once (mix), n ( ) Other reasons, n ( ) Clinical symptoms of uremia, n ( ) Volume overload, n ( ) Unknown Reasons for becoming NP Acute factor deteriorating previous GFR, n ( ) Mix reasons, n ( ) Others, n ( ) Patient lack of compliance follow-up, n ( ) GFR loss faster than expected, n ( ) Patient related healthcare bureaucracy issues, n ( ) Non-functional vascular access at start, n ( ) Unknown 27 (9) 19 (6) 34 (12) 103 (36) 54 (19) 31 (11) 13 (10) 10 (3) 12 (12) 10 (10) 12 (12) 26 (25) 31 (30) 4 (4) 9 (9) 9 (8) 15 (9) 9 (5) 22 (12) 77 (43) 23 (13) 27 (15) 4 (2) 1 (0.4) <0.001 8 (2.5) 20 (6.3) 5 (1.5) 79 (25) 13 (4) 126 (40) 55 (17.4) 10 (3) 2 (2) 7 (7) 3 (3) 22 (21) 6 (6) 39 (27) 26 (23) 8 (7) 6 (3) 13 (6) 2 (1) 57 (28) 7 (3) 87 (43) 29 (14) 2 (0.9) 0.20 NP 316 ER+NP 113 LR+NP 203 P-valueAbbreviations: CKD, chronic kidney disease; NP, non-planned patients; ER+NP, early referral and non-planned patients; LR+NP, late referral and nonplanned patients. doi:10.1371/journal.pone.0155987.treferral nephrologists). Additionally, patients with NP start had worse clinical status at dialysis start and worse access management (Table 1 and Fig 2). Factors associated with P start were evaluated by a multivariate logistic regression analysis and are described in Table 3. Factors were adjusted for age and gender. More patients received education in the P (218/231, 94 ) than in the NP group (218/316, 69 ). At the time of modality information, P start patients had lower serum creatinine, longer predialysis follow-up and more patients were started on PD as RRT (p 0.01) (Table 4).Early ReferralsThe group of ER + NP patients showed markedly lower indicators of quality care than ER+P patients as well as less use of PD (p<0.05) [Table 4]. On the other hand, in a multivariate logistic regression analysis, the ER+P group was associated with eGFR >8.2 ml/min (OR 2.64, p = 0.001) and with information provided >2 months before initiation of dialysis (OR 38.5, p = 0.001). The final model was adjusted for age, gender, renal etiology and eGFR.PD as RRTPD was performed as first dialysis modality in 8.2 of patients (n = 45), with 5/45 as unplanned start. On the other hand, 14 NP patients who started with HD and a central venous line were switched to PD in the next six weeks reaching a final PD incidence of 59/547 (10.7 ) (Table 5 and Fig 3). PD incidence varied with age and patient subgroup (Fig 3). Patients who were not informed about RRT modalities never used PD. It is worthy to note that optimal care conditions had a big impact on the probability of PD as final RRT modality. Almost half of the PD patients (29/PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,6 /Referral, Modality and Dialysis Start in an International SettingFig 2. Type of dialysis access at first dialysis session accordingly with different studied subgroups. Abbreviations: ER+P, early referral and planned patients; ER+NP, early referral and non-planned patients; LR+P, late referral and planned patients; LR+NP, late referral and non-planned patients. PD, peritoneal dialysis; HD, hemodialysis; AVF, arterio-venous fistula. Figure represents a diagram of bars showing the different types of accesses at first dialysis session. Accesses were as follows for the total popula.

Suggested by our results are similar to others [8, 25]. Our findings for

Suggested by our results are similar to others [8, 25]. Our findings for RO5186582 biological activity childhood neglect agree with a US study showing faster BMI gain, 15 to 28y [8] and a Danish study showing higher obesity risk in young adulthood ( 20y) using similar parental care measures to ours [38]; whereas for courtsubstantiated neglect in the US, no excess BMI was seen at 31y [37]. Whilst differences in neglect measures may account for some discrepancies, our study suggests that associations vary with age, although reasons for this variation with age are unknown. Childhood maltreatment groups differed from their contemporaries in many aspects of their lives, such as lower qualifications and higher unemployment /smoking rates, 23y to 50y. In parallel, some maltreatment groups had lower BMI in childhood, followed by a faster rate of BMI gain and higher adult BMI. Because associations for child and adult BMI can be in opposite directions, studies of specific ages may not capture the full association of maltreatment with BMI and obesity. Child maltreatment has been linked to multiple long-term outcomes including several chronic diseases [1]. One plausible pathway through which adult health may be affected is via obesity, [3?] and excess BMI gain. BMI gain is important because even within the normal BMI range it has been linked to adverse health outcomes [39?3]. Hence, the faster BMI trajectory for some child maltreatments may have detrimental health consequences in the long-term. Not all child maltreatments showed consistent associations with BMI or obesity (e.g. psychological abuse) hence, summary maltreatment measures may be inadequate to investigate long-term relationships with BMI or obesity. This is a study of one cohort and results may differ in other populations given their prevalence of child maltreatment or obesity. Future studies are needed to track long-term outcomes of child maltreatment, identify factors that may remedy adverse outcomes, monitor younger generations and support efforts aimed at primary prevention.Supporting InformationS1 Table. OR (95 CI) for obesity (!95th percentile) at each age by childhood maltreatment (unadjusted). (DOCX) S2 Table. Changing Odds ratio (OR) (95 CIs) for obesity with age for childhood maltreatments. (DOCX) S3 Table. (1) Mean differences in zBMI (95 CIs) at 7y and rate of change in zBMI (7?0y) and (2) Changing Odds ratio (OR) (95 CIs) for obesity with age in Females. (DOCX)PLOS ONE | DOI:10.1371/journal.pone.0119985 March 26,13 /Child Maltreatment and BMI TrajectoriesAcknowledgmentsWe are grateful to PX-478 site participants of the 1958 British birth cohort.Author ContributionsConceived and designed the experiments: CP. Performed the experiments: SMPP LL. Analyzed the data: SMPP LL. Contributed reagents/materials/analysis tools: CP SMPP LL. Wrote the paper: CP.
Pathogenic Escherichia coli are a major source of morbidity, and less-commonly mortality, due to infections of the urinary tract, intestinal tract, and bloodstream. Most E. coli virulence factors identified to date target interactions with host intestinal epithelial cells. For instance, Esp and Nle Type III secretion system effectors from enteropathogenic (EPEC) and enterohemorrhagic (EHEC) E. coli disrupt internalization, protein secretion, NF-B signaling, MAPK signaling, and apoptosis in eukaryotic cells[1]. Certain strains of pathogenic E. coli, including the enteroaggregative E. coli, also form biofilms in the intestine, secrete toxins that cause fluid secretion fr.Suggested by our results are similar to others [8, 25]. Our findings for childhood neglect agree with a US study showing faster BMI gain, 15 to 28y [8] and a Danish study showing higher obesity risk in young adulthood ( 20y) using similar parental care measures to ours [38]; whereas for courtsubstantiated neglect in the US, no excess BMI was seen at 31y [37]. Whilst differences in neglect measures may account for some discrepancies, our study suggests that associations vary with age, although reasons for this variation with age are unknown. Childhood maltreatment groups differed from their contemporaries in many aspects of their lives, such as lower qualifications and higher unemployment /smoking rates, 23y to 50y. In parallel, some maltreatment groups had lower BMI in childhood, followed by a faster rate of BMI gain and higher adult BMI. Because associations for child and adult BMI can be in opposite directions, studies of specific ages may not capture the full association of maltreatment with BMI and obesity. Child maltreatment has been linked to multiple long-term outcomes including several chronic diseases [1]. One plausible pathway through which adult health may be affected is via obesity, [3?] and excess BMI gain. BMI gain is important because even within the normal BMI range it has been linked to adverse health outcomes [39?3]. Hence, the faster BMI trajectory for some child maltreatments may have detrimental health consequences in the long-term. Not all child maltreatments showed consistent associations with BMI or obesity (e.g. psychological abuse) hence, summary maltreatment measures may be inadequate to investigate long-term relationships with BMI or obesity. This is a study of one cohort and results may differ in other populations given their prevalence of child maltreatment or obesity. Future studies are needed to track long-term outcomes of child maltreatment, identify factors that may remedy adverse outcomes, monitor younger generations and support efforts aimed at primary prevention.Supporting InformationS1 Table. OR (95 CI) for obesity (!95th percentile) at each age by childhood maltreatment (unadjusted). (DOCX) S2 Table. Changing Odds ratio (OR) (95 CIs) for obesity with age for childhood maltreatments. (DOCX) S3 Table. (1) Mean differences in zBMI (95 CIs) at 7y and rate of change in zBMI (7?0y) and (2) Changing Odds ratio (OR) (95 CIs) for obesity with age in Females. (DOCX)PLOS ONE | DOI:10.1371/journal.pone.0119985 March 26,13 /Child Maltreatment and BMI TrajectoriesAcknowledgmentsWe are grateful to participants of the 1958 British birth cohort.Author ContributionsConceived and designed the experiments: CP. Performed the experiments: SMPP LL. Analyzed the data: SMPP LL. Contributed reagents/materials/analysis tools: CP SMPP LL. Wrote the paper: CP.
Pathogenic Escherichia coli are a major source of morbidity, and less-commonly mortality, due to infections of the urinary tract, intestinal tract, and bloodstream. Most E. coli virulence factors identified to date target interactions with host intestinal epithelial cells. For instance, Esp and Nle Type III secretion system effectors from enteropathogenic (EPEC) and enterohemorrhagic (EHEC) E. coli disrupt internalization, protein secretion, NF-B signaling, MAPK signaling, and apoptosis in eukaryotic cells[1]. Certain strains of pathogenic E. coli, including the enteroaggregative E. coli, also form biofilms in the intestine, secrete toxins that cause fluid secretion fr.

Atient preferences and perceptions regarding aggressive treatment. While more white subjects

Atient preferences and perceptions regarding aggressive treatment. While more white subjects indicated a willingness to participate in a clinical trial involving a new, experimental medication compared to African-Americans, this difference was not Oroxylin A chemical information statistically significant (80.7 vs 68.7 , P = 0.10). In contrast, more whites than purchase LOR-253 African-Americans were willing to receive CYC if their lupus worsened and if their doctor recommended the treatment (84.9 vs 67.0 , P = 0.02). No significant racial/ethnic differences were observed in the perceptions of effictiveness and risk of CYC. Table 3 demonstrates patient health attitudes and beliefs. Compared with whites, African-Americans were more likely to believe that prayer is helpful for their lupus (P < 0.001) and to utilize prayer to cope with their disease (P < 0.01). In addition, African-American patients were more likely than whites to believe that their health outcomes are controlled by their own internal actions (P < 0.01) and by powerful others (P < 0.01). They also reported higher trust in physicians than white patients (P = 0.01).Reliability and validity of measuresReliability Supplementary Table S1 (available as supplementary data at Rheumatology Online) shows the Cronbach a coefficient values of several multi-item components of the survey. Correlational analyses Willingness to participate in a clinical trial positively correlated with willingness to receive CYC (r = 0.24, P = 0.001). Perceived effectiveness negatively correlated with perceived risk of CYC treatment (r = ?.32, P < 0.001). Trust in physicians negatively correlated with perceived discrimination in the medical setting (r = ?.60, P < 0.001). Factor analyses The results of the factor analyses are shown in supplementary Table S2 (available as supplementary data at Rheumatology Online). (1) Beliefs about CYC. Effectiveness of treatment items all loaded on Factor 1, which accounted for 70 of the variance. Familiarity with CYC items loaded on Factor 2, which accounted for 23 of the variance. (2) Trust in physicians and perceived discrimination. All trust in physicians items loaded on Factor 1, which accounted for 86 of the variance. All perceived discrimination items loaded on Factor 2, which accounted for 13 of the variance.ResultsA total of 235 SLE patients were initially considered for participation in the study. One hundred and ninety-five were eligible and consented to participate. Data from 120 African-American and 62 white patients were evaluated; 92.3 were women (Fig. 1). Participants’ sociodemographic and clinical characteristics are shown in Table 1. Statistically significant differences were observed between the racial/ethnic groups. African-American SLE patients, compared with white SLE patients, were less likely to have more education than a high-school degree (64.2 vs 83.9 , P < 0.01), were less likely to be employed (38.5 vs 56.5 , P = 0.02) and were more likely to have lower incomes (33.6 vs 5.4 with annual income of < 10 000, P < 0.001). Although African-American patients had a higher Charlson Comorbidity Index mean score than white patients (2.34 vs 1.85, P = 0.03), the mean SLEDAI score, SLICC Damage Index score, disease duration and number of immunosuppressant agents used did not differ.Preferences: bivariate analysesTable 4 shows the patient characteristics and beliefs that were significantly related to patients’ CYC treatment preference. Compared with SLE patients unwilling to receive the medicati.Atient preferences and perceptions regarding aggressive treatment. While more white subjects indicated a willingness to participate in a clinical trial involving a new, experimental medication compared to African-Americans, this difference was not statistically significant (80.7 vs 68.7 , P = 0.10). In contrast, more whites than African-Americans were willing to receive CYC if their lupus worsened and if their doctor recommended the treatment (84.9 vs 67.0 , P = 0.02). No significant racial/ethnic differences were observed in the perceptions of effictiveness and risk of CYC. Table 3 demonstrates patient health attitudes and beliefs. Compared with whites, African-Americans were more likely to believe that prayer is helpful for their lupus (P < 0.001) and to utilize prayer to cope with their disease (P < 0.01). In addition, African-American patients were more likely than whites to believe that their health outcomes are controlled by their own internal actions (P < 0.01) and by powerful others (P < 0.01). They also reported higher trust in physicians than white patients (P = 0.01).Reliability and validity of measuresReliability Supplementary Table S1 (available as supplementary data at Rheumatology Online) shows the Cronbach a coefficient values of several multi-item components of the survey. Correlational analyses Willingness to participate in a clinical trial positively correlated with willingness to receive CYC (r = 0.24, P = 0.001). Perceived effectiveness negatively correlated with perceived risk of CYC treatment (r = ?.32, P < 0.001). Trust in physicians negatively correlated with perceived discrimination in the medical setting (r = ?.60, P < 0.001). Factor analyses The results of the factor analyses are shown in supplementary Table S2 (available as supplementary data at Rheumatology Online). (1) Beliefs about CYC. Effectiveness of treatment items all loaded on Factor 1, which accounted for 70 of the variance. Familiarity with CYC items loaded on Factor 2, which accounted for 23 of the variance. (2) Trust in physicians and perceived discrimination. All trust in physicians items loaded on Factor 1, which accounted for 86 of the variance. All perceived discrimination items loaded on Factor 2, which accounted for 13 of the variance.ResultsA total of 235 SLE patients were initially considered for participation in the study. One hundred and ninety-five were eligible and consented to participate. Data from 120 African-American and 62 white patients were evaluated; 92.3 were women (Fig. 1). Participants’ sociodemographic and clinical characteristics are shown in Table 1. Statistically significant differences were observed between the racial/ethnic groups. African-American SLE patients, compared with white SLE patients, were less likely to have more education than a high-school degree (64.2 vs 83.9 , P < 0.01), were less likely to be employed (38.5 vs 56.5 , P = 0.02) and were more likely to have lower incomes (33.6 vs 5.4 with annual income of < 10 000, P < 0.001). Although African-American patients had a higher Charlson Comorbidity Index mean score than white patients (2.34 vs 1.85, P = 0.03), the mean SLEDAI score, SLICC Damage Index score, disease duration and number of immunosuppressant agents used did not differ.Preferences: bivariate analysesTable 4 shows the patient characteristics and beliefs that were significantly related to patients’ CYC treatment preference. Compared with SLE patients unwilling to receive the medicati.

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript

Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with PD0325901 mechanism of action either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These get SC144 dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.Ized by weak communal goals.Alcohol Clin Exp Res. Author manuscript; available in PMC 2016 December 01.Meisel and ColderPageInjunctive NormsAuthor Manuscript Author Manuscript Author Manuscript Author ManuscriptInjunctive Norms X Communal Goals As depicted in Panel C of Figure 1, 6th grade injunctive norms were associated with increased probability of alcohol in 7th grade alcohol use for adolescents with low (OR=2.91, p<.05), but not high (OR=0.76, p>.05) levels of communal goals. Moving to later adolescence, high levels of injunctive norms in 9th grade were associated with increased probability of alcohol use in 10th grade for adolescents with both low (OR=1.80, p>.05) and high (OR=2.68, p>.05) levels of communal goals. This pattern suggests that injunctive norms take on increasing importance in later adolescence across the spectrum of communal goals. These findings provide partial support for the hypothesized interaction between injunctive norms, high communal goals and grade but also contradict our hypotheses such that high levels of injunctive norms and low levels of communal goals predicted higher levels of alcohol use in later adolescence.DiscussionAlthough social norms are robust predictors of adolescent alcohol use (Borsari and Carey, 2001; Perkins, 2002), theoretical formulations suggest that the impact social norms have on behavior varies depending on their salience. Few studies have examined potential mechanisms that may make social norms more or less salient to influence adolescent early drinking. The current study looked to elucidate moderating factors that might impact the strength of association between social norms on adolescent early alcohol use. Specifically, agentic and communal social goals were tested as moderators of the association between descriptive and injunctive norms and alcohol use across early to middle adolescence. Findings supported the moderating role of social goals, but the effects depended on grade. Partial support was found for our hypothesis that descriptive norms would be a stronger predictor of alcohol use for adolescents with high levels of agentic goals. Perceptions of peer alcohol use (descriptive norms) were not prospectively associated with 7th grade alcohol use for adolescents with either low or high agentic goals. However, in later adolescence, descriptive norms came to be prospectively associated with 10th grade alcohol use for individuals characterized by high levels of agentic goals, suggesting that the moderating influence of agentic goals do not emerge until later adolescence. Several lines of evidence suggest that adolescence who value status and power (high agentic goals) may conform to peer drinking norms as a means to obtain or maintain social standing. Recent work suggests that alcohol use is linked to popular status, especially in later adolescence (Allen et al., 2005; Balsa et al., 2011). Moreover, there is evidence that popular peers are particularly susceptible to peer social norms because they are highly attuned to the behaviors of their peers and motivated to maintain their social status (Allen et al., 2005; Cillessen and Mayeux, 2004). These dynamics are likely not limited to alcohol use as evident by studies showing that popularity and high agency are associated with a wide variety of risk behavior (Mayeux et al., 2008; Markey et al., 2005). Contrary to our hypotheses, descriptive norms were prospectively associated with 7th grade alcohol use for adolescents with high leve.

Ilitate the work of JZ programme staff and foster the health

Ilitate the work of JZ programme staff and foster the health and safety of FSW. We describe each of these main activities and cross-cutting themes below. Core programmatic activities A welcoming HIV-1 integrase inhibitor 2 site clinic setting and high-quality clinical services–FSWs face the dual stigma of HIV/STI and sex work, creating barriers to seeking and receiving medical care. JZ provides a safe physical and social space for FSW to see doctors and share their lives. The JZ clinic and activity centre are located in a discrete, convenient area within the city. This centre was intentionally designed for comfort: a clean, warm environment, a reception desk at the entrance, plants and decorations, a television and two massage beds at the back of the first floor. On the second floor, an outside room is used as a waiting room. The walls are decorated with IEC materials and notes written by FSW with wishes and `words from the heart’. Practical tips for women are also posted, such as an example of counterfeit money (a common problem in China) with a description of how to identify it. A round table and drinking water are always set out for chatting. Separated from the waiting room, an inner room is outfitted with a clean bed and standard medical facilities for physical exams, STI testing and treatment. The clinic is reserved especially for FSW and is not open to the public. As Dr Z noted, this allows the clinic to offer a safe, confidential space ?a feature that was highly valued by the FSW we interviewed. FSWs come to the clinic through outreach contact and introduction by other FSW. Women were also mobilised to bring new FSW and their regular partners (boyfriends, regular male clients) for STI treatment. The welcoming environment and high quality of clinic service, as illustrated below, made JZ clinic well known via word of mouth among the local FSW community. In addition, to avoid being recognised as the `FSW clinic’, which might bring stigma upon clientele, Dr Z named the clinic the `JZ Love and Health Consultation Centre’. Within the welcoming clinic environment, JZ staff provides high-quality reproductive and gynaecological services including physical exams and blood testing for syphilis and HIV. When the JZ clinic first opened, services were provided free of charge. Later, a basic feefor-service plan (e.g. 3? USD/blood test for STI) was implemented in order to foster FSWs’ self-responsibility to care about their health and to support the financial sustainability of the project. Dr Z is a trained expert in STI and gynaecology. According to her, `you must know your own body well, rather than only focusing on getting the disease cured; one of our goals is to increase health awareness in everyday life’. As we observed, the exam process was usually accompanied by dialogue on how a woman may have gotten sick (e.g. partners, behaviours) and how to avoid getting sick in the future. Dr Z approached FSW as if they were friends or sisters when talking about their sexual relationships. The following passage describes a typical clinic scene based on our fieldwork observations:Glob Public Health. Author manuscript; available in PMC 2016 August 01.Author Procyanidin B1 cost manuscript Author Manuscript Author Manuscript Author ManuscriptHuang et al.PageFSW usually came either with another female friend, or their boyfriends (occasionally with pimps) in late morning and early afternoon before their business started. In a situation with boyfriends or pimps there (at clinic), the staff would avoid topic.Ilitate the work of JZ programme staff and foster the health and safety of FSW. We describe each of these main activities and cross-cutting themes below. Core programmatic activities A welcoming clinic setting and high-quality clinical services–FSWs face the dual stigma of HIV/STI and sex work, creating barriers to seeking and receiving medical care. JZ provides a safe physical and social space for FSW to see doctors and share their lives. The JZ clinic and activity centre are located in a discrete, convenient area within the city. This centre was intentionally designed for comfort: a clean, warm environment, a reception desk at the entrance, plants and decorations, a television and two massage beds at the back of the first floor. On the second floor, an outside room is used as a waiting room. The walls are decorated with IEC materials and notes written by FSW with wishes and `words from the heart’. Practical tips for women are also posted, such as an example of counterfeit money (a common problem in China) with a description of how to identify it. A round table and drinking water are always set out for chatting. Separated from the waiting room, an inner room is outfitted with a clean bed and standard medical facilities for physical exams, STI testing and treatment. The clinic is reserved especially for FSW and is not open to the public. As Dr Z noted, this allows the clinic to offer a safe, confidential space ?a feature that was highly valued by the FSW we interviewed. FSWs come to the clinic through outreach contact and introduction by other FSW. Women were also mobilised to bring new FSW and their regular partners (boyfriends, regular male clients) for STI treatment. The welcoming environment and high quality of clinic service, as illustrated below, made JZ clinic well known via word of mouth among the local FSW community. In addition, to avoid being recognised as the `FSW clinic’, which might bring stigma upon clientele, Dr Z named the clinic the `JZ Love and Health Consultation Centre’. Within the welcoming clinic environment, JZ staff provides high-quality reproductive and gynaecological services including physical exams and blood testing for syphilis and HIV. When the JZ clinic first opened, services were provided free of charge. Later, a basic feefor-service plan (e.g. 3? USD/blood test for STI) was implemented in order to foster FSWs’ self-responsibility to care about their health and to support the financial sustainability of the project. Dr Z is a trained expert in STI and gynaecology. According to her, `you must know your own body well, rather than only focusing on getting the disease cured; one of our goals is to increase health awareness in everyday life’. As we observed, the exam process was usually accompanied by dialogue on how a woman may have gotten sick (e.g. partners, behaviours) and how to avoid getting sick in the future. Dr Z approached FSW as if they were friends or sisters when talking about their sexual relationships. The following passage describes a typical clinic scene based on our fieldwork observations:Glob Public Health. Author manuscript; available in PMC 2016 August 01.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptHuang et al.PageFSW usually came either with another female friend, or their boyfriends (occasionally with pimps) in late morning and early afternoon before their business started. In a situation with boyfriends or pimps there (at clinic), the staff would avoid topic.

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance

Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article order Lonafarnib contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor Talmapimod site invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.Re typified by high levels of reciprocity (12?5), implying that mutual acceptance of new links is the social norm. Our study builds upon this work in three ways. First, our design is fully endogenous, allowing individuals to decide with whom they will make and break ties. As we explain below, the resulting effect sizes are much larger than in previous studies of dynamic networks (8, 9), reaching close to 100 cooperation in some cases. Second, we consider an extremely wide range of update rates, affording us a much clearer understanding of the importance of varying rates. We find no evidence of the hypothesized threshold effect (9, 10), instead finding significant and positive increases in cooperation at rates well below those previously reported. Finally, and in contrast to both previous studies that considered only one set of payoffs, we manipulate the payoff structure itself, effectively varying the attractiveness of the “outside option” (16), meaning roughly the payoff associated with choosing not to interact with a potential partner. We find that only in the presence of an attractive outside option do conditional cooperators punish defectors (by proactively deleting ties with them). By contrast, when the outside option is less attractive, we find that cooperators tolerate defecting partners, eventually leading them to defect themselves. Our work is also related more generally to a number of recent experiments that have investigated various aspects of the relationship between cooperation and partner selection, such as unilateral vs. bilateral choice (17, 18), the effect of introducing an outside option of varying attractiveness (16), and the attributes of the individuals (age, sex, race, etc.) as predictors of selection and cooperation (19, 20). Although our treatment of the outside option is consistent with previous work (16), it is distinct in that it extends it to the case of a dynamic network. Finally,Author contributions: J.W., S.S., and D.J.W. designed research; J.W. and S.S. performed research; J.W., S.S., and D.J.W. analyzed data; and S.S. and D.J.W. wrote the paper. The authors declare no conflict of interest.Freely available online through the PNAS open access option.To whom correspondence may be addressed. E-mail: [email protected], [email protected] microsoft.com, or [email protected] article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1120867109/-/DCSupplemental.www.pnas.org/cgi/doi/10.1073/pnas.PNAS | September 4, 2012 | vol. 109 | no. 36 | 14363?SOCIAL SCIENCESThis article is a PNAS Direct Submission. M.O.J. is a guest editor invited by the Editorial Board.other related work (21, 22) has examined how individuals select groups or are excluded by them. Although at a high level these papers clearly resemble both the partner selection literature and dynamic updating studies such as ours, they differ substantially from both literatures in that the object of selection (21) or the actor (22) is the group, not the individual. Experimental Setup We conducted a series of online human subjects experiments in which groups of 24 participants played an iterated prisoner’s dilemma (PD) game, where in addition to choosing their action each round–cooperate or defect–they also were given the opportunity to update their interaction partners at some specified rate, which was varied across experimental conditions. (See SI Appendix, Figs. S1 and S2 for details of the experimental platform and recr.

Between the salaries of medical doctors and the TCs. . .[surgical assistants

Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are PNPPMedChemExpress PNPP supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher AICA Riboside biological activity reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.Between the salaries of medical doctors and the TCs. . .[surgical assistants]. (Medical Doctor, Mozambique, Study # 4)Contrasting the findings associated with lower and higher levels of task shifting, it appears that structured career planning is more of an issue for skilled staff taking on new tasks. With that said, lower-level staff involved in task shifting, especially new lower cadres such as that envisioned in the Kenyan scheme, seem likely to view their training as an opportunity to become recognised providers of medical care. To prevent lower cadres being tempted to enact informal charging or to misrepresent themselves as nurses or doctors, lower cadres should be closely monitored and adequately paid. In addition, although this is less of a concern for lowerlevel workers, their formal position within the hierarchy of healthcare positions should be planned, and the requirements for entry to more advanced posts made clear.DiscussionLimitations and strengthsDefining task shifting in literature search Task-shifting interventions may not be labelled as such in literature. For example, systematic review of midwifery services found that although the term `task shifting’ was used commonly in relation to community health workers, `task shifting’ was used infrequently when describing interventions involving midwives (Colvin et al. 2013). Our literature search included terms that were synonymous/near synonymous with task shifting as well as a review of secondary references. The list of search terms was not exhaustive and it is possible that the studies identified were more likely to represent some cadres than others. Obtaining rich qualitative data As mentioned in the discussion on the quality of studies included in the review, qualitative studies published in health journals provide a diverse, but somewhat limited amount of data. Further grey literature searches with focus on obtaining unpublished documents from various health organisations and identifying extensive ethnographic projects conducted by anthropologists would potentially provide richer data and inform subsequent analysis. Quality of the studies in the review Studies were included regardless of the quality score assigned. All studies provided narratives that were helpful in drawing a larger picture about the impact of task-shifting programmesAt the same time lower skilled cadres were often seen as part of the solution to providing healthcare to underserviced areas. They had good retention rates compared to higher skilled staff and they came at a substantially lower cost. It was widely acknowledged that lower, less skilled cadres performing tasks at a lower cost was in fact what made task shifting a plausible mechanism for providing additional health services in the first place:Skills of lower cadre health workers and especially community health workers are hardly portable both nationally and internationally. Lower cadre health workers can also be easily and cheaply recruited from within areas where they live and where they are supposed to be working. It is thus easy to retain these workers as?2016 The Authors. Journal of Clinical Nursing Published by John Wiley Sons Ltd. Journal of Clinical Nursing, 25, 2083?ReviewReview: Task shifting in sub-Saharan Africaon health workers. Due to limited researcher reflexivity and scant information about study informants, reliability of individual study findings was at times difficult to ascertain. It is likely that important perspectives.

Rey) with vestiges of sauropod tracks; south of James Price Point.

Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional Cycloheximide chemical information practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be XR9576MedChemExpress Tariquidar overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.Rey) with vestiges of sauropod tracks; south of James Price Point. B, a similar but smaller feature at James Price Point, at the very margin of the lower-lying areas shown in Figure 24. The two water-filled areas at left and right have been trodden down by sauropods to leave an `anticlinal’ fold between them. doi:10.1371/journal.pone.0036208.gtransmitted reliefs of an entire trackway. In theory the same concession might extend ultimately to regions of deformed bedding that resemble minor tectonic structures and even to the larger features of physical geography seen at James Price Point. In effect, the state of ichnotaxonomy would come to resemble that of zoological taxonomy when the available names of taxa were extended to the `work’ of animals [47]. Seemingly valid ichnotaxonomic names might be bestowed on geographic features of the Dampier coast, in just the way that the name Homo sapiens might be applied to all and any human artefacts, from stone axes to space shuttles. It seems preferable to avoid that incongruous outcome by maintaining the genuine, if arbitrary, distinction between footprints and sedimentary structures (patterns of deformation) which are associated with footprints. That policy is, in fact, consistent with conventional practice in ichnotaxonomy, where features of transmitted relief are disregarded or treated, at best, as an indirect and inferior source of information about the `true’ footprints. Footprints, sensu stricto, are definitely objects of organic origin whereas the development of transmitted reliefs depends as much on the nature of the substrate as it does on the intervention of a track-maker. In fact, the development of transmitted relief, in the broadest sense, does not necessarily require the active involvement of a track-maker. In theory transmitted reliefs might be produced by organisms which are inert (e.g. a carcass settlingon to the floor of a lagoon) or by the impact of inorganic objects such as drop-stones, lapilli, volcanic bombs, meteorites or hail. Even so, the taxonomic implications should not be overrated. Ideally ichnotaxa should be established on type material comprising one or more footprints (true tracks), not transmitted reliefs (undertracks). But that is merely the description of ideal practice; it is not the stipulation of a mandatory requirement. Each case is to be judged on its individual merits, and no great harm will ensue if a valid ichnospecies should transpire to be founded on transmitted relief rather than a footprint (a true track). In practice all that matters is that type material should be adequate and diagnostic, regardless of its status as footprint or transmitted relief. That concession is not the thin end of a wedge that would ultimately permit all and any transmitted reliefs to be classified as conventional ichnotaxa, because only the most proximal reliefs are likely to retain the morphological details required to discriminate a valid ichnospecies. The more distal transmitted reliefs lack such consistent morphological detail and are far less likely to be mistaken for footprints (true tracks) – though they might easily and more appropriately be classified as a series of sedimentary structures (e.g. bowls, basins, troughs and folds of various shapes and sizes).Previous interpretationsSome of the sedimentary features described here may have attracted attention in the past, though the sauropod tracks werePLoS ONE | www.plosone.orgSubstrates Deformed by Cretaceous Dinosaurs.

Nction constituted by suggested learning activities and the requirements of the

Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important LLY-507 cost aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of get INK1117 antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.Nction constituted by suggested learning activities and the requirements of the learning environment from the foundation and AR characteristics can amend the gap in the learning outcomes and medical learners’ personal paradigms. The learning outcome, which combines Miller’s pyramid and Bloom’s taxonomy, can clarify the objectives and expectations and avoid teaching pitched at the wrong level [29]. Furthermore, we used a global health challenge–antibiotic resistance–as an application example and chose one important aspect that is the general practitioners’ rational use of antibiotics, to which to apply the MARE framework. With this framework, the expected abilities of GPs’ rational use of antibiotics are described specifically and may easily be executed and evaluated. The abilities were compared with the GP personal paradigm to solidify GP practical learning objectives and to help design learning environments and activities. Future work will focus on the implementation of the proposed framework by developing a mobile phone-based AR app for GP training and for conducting evaluations in China.ConclusionsDue to the traditional teaching focus on recalling facts, health care professionals face the challenge of transforming knowledge into practice in health care settings. AR could provide a means to resolve this challenge, but it lacked a theory-guided design. Most AR apps still use traditional learning activities–see one,Conflicts of InterestNone declared.
REFLECTIONS: NEUROLOGY AND THE HUMANITIES Section Editor Michael H. Brooke, MDReflections for FebruaryMatthew B. Jensen, MD Erika L. Janik, MAWHAT’S WRONG WITH EVERYBODY?Address correspondence and reprint requests to Dr. Matthew B. Jensen, Comprehensive Stroke Program, Department of Neurology, School of Medicine and Public Health, University of Wisconsin, 1685 Highland Ave., Room 7273, Madison, WI 53705-2281 [email protected] wife and I at the breakfast table Sunday paper between us, describing a disaster somewhere, she concludes with, “The people ate can six fizzle.” “What?” I ask, looking up from the funny pages. Puzzled, she looks at me. “Worm didn’t hake Monday.” I laugh at this strange joke from my oldest friend, but stop when her face grows concerned. I try to ask her what’s wrong, but she ignores my question, blabbering more gibberish with a straight face. I rise to call 911 but she beats me to it. The paramedics arrive and I tell them what happened, but they ignore me, shining a light in my eyes, instructing me to “fop hund rund sun.” No, you idiots, there’s something wrong with my wife! In the Emergency Room a parade of doctors, nurses, others, ignoring my questions, talking among themselves, gobbletygook, claptrap, nonsense. Is this a big joke? Have we been attacked by nerve gas and I’m the only one immune? Who can I call for this, the Pentagon? They give me something through the IV, my wife holds my hand crying. The doctor returns to my room, on his last visit he earnestly told me to “zip the wachet unto three foamy.” I ask him for the thousandth time what is going on, but this time he looks at me, smiles, and says, “Good, now tell me your name.”Supported by grant 1UL1RR025011 from the Clinical and Translational Science Award (CTSA) program of the National Center for Research Resources (NCRR), NIH. 582 Copyright ?2011 by AAN Enterprises, Inc.
Two populations of neurons in the arcuate nucleus of the hypothalamus (ARH) play an essential role in the regulation of energy h.

Anization and complexity. For example, if a particular set of states

Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a MS023 web highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, (Z)-4-Hydroxytamoxifen manufacturer decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.Anization and complexity. For example, if a particular set of states and their dependent structure correspond to a highly robust yet agile collective motion, then one can use this information theoretic inspired metrics for engineering the agent-to-agent interactions rather than focusing on the highly expensive computation strategy for an agent based model to achieve a certain degree of emergence, self-organization and complexity. We clarify this further in discussion section of manuscript. This framework can also help to study the evolution of the motion of various animal groups in nature to better understand their means to achieve energy efficiency46. The remaining of this paper is organized as follows: In the first section of results, we present our framework to extract the possible states in the collective motion and the strategy to build the corresponding energy landscape for transitions between them. To demonstrate the benefits of our approach, we first apply this strategy to quantify the energy landscape of a self-organizing model of a simulated group of agents based on local interactions among its individuals. Next, we define the missing information for the group structure. In the second section, we apply the same framework to three natural groups of swimming bacteria, flying pigeons and ants and study their energy landscapes. We define emergence, self-organization, and quantify the complexity of a collective motion based on these newly introduced metrics. For the case of bacteria, we concluded that adding chemoattractant to the environment, decreases the number of possible states for the group motion and the free energy landscape is smoother compared to the case without chemoattractant. Finally, the discussion section concludes the paper and outlines some future research directions.ResultsEstimating the free energy landscape for a collective motion based on identified spatio-temporal structural states of the group. The agents move coherently within a collective group while interactingwith their immediate neighbors and determine their overall trajectory of motion with respect to other agents. Consequently, the group’s structure evolves among various spatio-temporal structural states. We can identify and extract these states of the group moving in three-dimensional space from the individuals’ trajectories using our algorithm explained as follow (see the free energy landscape section in the Methods for more details). First, we divide the trajectories of all the individuals into equal sub-intervals of a specific lenght. Next, we compute the multivariable probability distribution function of the location of all the individuals in every sub-interval (Fig. 1a). We use Kantorovich metric (see equation (5) in free energy landscape section in Methods) to cluster these subinterval time series based on their similarities and closeness in the probability distribution function (Fig. 1b). Each cluster contains subintervals with similar dynamical configuration and can be interpreted as a distinct state.Scientific RepoRts | 6:27602 | DOI: 10.1038/srepwww.nature.com/scientificreports/Figure 2. Various collective patterns of a simulated model of a group of agents moving in a three dimensional space. (a) Torus: Individuals rotate around a center point within an empty space (See the simulation section in the Methods for more details about the model). (b) Swarm: Individuals show attraction and repulsion behavior between themselves and there is no ori.

Ients or the finer points of copyright law. Curious how a

Ients or the finer points of copyright law. Curious how a larger organisation might have responded, I contacted the Head of Wellcome Images, Catherine Draycott.29 The Wellcome has over 40,000 clinical and biomedical images in its online database, alongside over 100,000 photographs of paintings, prints, drawings, manuscripts, rare books and archive material from the Wellcome Library collections. A search for historical images of plastic surgery turns up an album of First World War photographs from King George Military Hospital (later the Red Cross Hospital) in London: pictures that would have served the purposes of BioShock’s art department just as well as those featured in Project Fa de.30 Wellcome images are generally free of charge for study, teaching and academic publication, but commercial use is chargeable and governed by terms and conditions. The Wellcome’s LM22A-4 web definition of “commercial” is specific and wide-ranging, covering everything from the reproduction of images in medical textbooks to “artist reference” fees for CGI and special effects. If a makeup artist on the BBC hospital drama Casualty needs to make a gunshot wound look realistic, they can — in the absence of an actual shooting — use the service provided by Wellcome Images.31 Would Wellcome have permitted the developers of BioShock to use their photographs in the game? No, said Draycott, they wouldn’t: even though such a request might fall under the rubric of “artist reference”, it would have been considered unethical. The comparison she made was Benetton asking for images for an advertising campaign “for shock value”. Even if the patient could not be identified, “the usage would still have been unethical”.32 Pending a trans-Atlantic copyright case, where does this leave Henry Lumley? Should we conclude that his ghostly presence in BioShock only “deepens the moral grey areas” of the game, to quote one blogger?33 One of the problems with this conclusion is that it fails to address the concerns raised by players in the discussion forum, who point to a troubling interaction — or order ALS-008176 blurring — of real and imaginary worlds. In contrast to Sicart, who brackets the world outside the game, what disturbs the players (or some of them) is precisely the intrusion of the historical Real. Here is the case against BioShock, from someone whose nom de plume is Nias Wolf: I just feel a little bad that we are using these poor souls (who fought in a war by the way) for entertainment. If I was disfigured horribly, and saw my face being portraid [sic.] as a monster, I would be greatly offended.P H OTO G R AP H I E SA few posts later he (or she) adds: “Honor the dead people. And honor soldiers too. I just want to keep that in mind.”35 One of the genuinely innovative — and truly eerie — things about BioShock is the way it incorporates found objects into the game world. One of these objects is Lumley’s photograph, but the commitment to realism is not confined to the game’s visuals. Each level or “deck” in Rapture has a different theme: the fisheries, the medical deck, arcadia all have distinctive musical and ambient elements: aleatoric music, solo cello and violin, and jazz piano are interspersed with recordings of buoy bells and boats, the distant sound of a concertina, footsteps, a car horn, voices. “I actually found the sound of an insane woman on the internet”, Garry Schyman explained, “and messed with her voice digitally and infused it into the score and it becomes a very scary element”. Sc.Ients or the finer points of copyright law. Curious how a larger organisation might have responded, I contacted the Head of Wellcome Images, Catherine Draycott.29 The Wellcome has over 40,000 clinical and biomedical images in its online database, alongside over 100,000 photographs of paintings, prints, drawings, manuscripts, rare books and archive material from the Wellcome Library collections. A search for historical images of plastic surgery turns up an album of First World War photographs from King George Military Hospital (later the Red Cross Hospital) in London: pictures that would have served the purposes of BioShock’s art department just as well as those featured in Project Fa de.30 Wellcome images are generally free of charge for study, teaching and academic publication, but commercial use is chargeable and governed by terms and conditions. The Wellcome’s definition of “commercial” is specific and wide-ranging, covering everything from the reproduction of images in medical textbooks to “artist reference” fees for CGI and special effects. If a makeup artist on the BBC hospital drama Casualty needs to make a gunshot wound look realistic, they can — in the absence of an actual shooting — use the service provided by Wellcome Images.31 Would Wellcome have permitted the developers of BioShock to use their photographs in the game? No, said Draycott, they wouldn’t: even though such a request might fall under the rubric of “artist reference”, it would have been considered unethical. The comparison she made was Benetton asking for images for an advertising campaign “for shock value”. Even if the patient could not be identified, “the usage would still have been unethical”.32 Pending a trans-Atlantic copyright case, where does this leave Henry Lumley? Should we conclude that his ghostly presence in BioShock only “deepens the moral grey areas” of the game, to quote one blogger?33 One of the problems with this conclusion is that it fails to address the concerns raised by players in the discussion forum, who point to a troubling interaction — or blurring — of real and imaginary worlds. In contrast to Sicart, who brackets the world outside the game, what disturbs the players (or some of them) is precisely the intrusion of the historical Real. Here is the case against BioShock, from someone whose nom de plume is Nias Wolf: I just feel a little bad that we are using these poor souls (who fought in a war by the way) for entertainment. If I was disfigured horribly, and saw my face being portraid [sic.] as a monster, I would be greatly offended.P H OTO G R AP H I E SA few posts later he (or she) adds: “Honor the dead people. And honor soldiers too. I just want to keep that in mind.”35 One of the genuinely innovative — and truly eerie — things about BioShock is the way it incorporates found objects into the game world. One of these objects is Lumley’s photograph, but the commitment to realism is not confined to the game’s visuals. Each level or “deck” in Rapture has a different theme: the fisheries, the medical deck, arcadia all have distinctive musical and ambient elements: aleatoric music, solo cello and violin, and jazz piano are interspersed with recordings of buoy bells and boats, the distant sound of a concertina, footsteps, a car horn, voices. “I actually found the sound of an insane woman on the internet”, Garry Schyman explained, “and messed with her voice digitally and infused it into the score and it becomes a very scary element”. Sc.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter.

Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis JNJ-54781532 site catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.Peficitinib clinical trials 0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.Tion: 34.5 AVF, 8 peritoneal catheter, 8.5 temporal hemodialysis catheter and 49 permanent HD catheter. For ER+P: 77 AVF, 21 peritoneal catheter, no temporal hemodialysis catheter and 2 permanent HD catheter. For ER+NP: 0.8 AVF, 2.6 peritoneal catheter, 9 temporal hemodialysis catheter and 88 permanent HD catheter. For LR+P: 89 AVF, 8 peritoneal catheter, no temporal hemodialysis catheter and 3 permanent HD catheter. For LR+NP: 0.4 AVF, 1 peritoneal catheter, 18 temporal hemodialysis catheter and 80 a permanent HD catheter. doi:10.1371/journal.pone.0155987.g59, 49 ) belonged to the optimal care patient group, whereas only 94/488 (19 ) of HD patients did (p = 0.01).Type of dialysis access (vascular or peritoneal)Access at first dialysis session is described in Fig 2. Serum creatinine and CCr 24h at the time of access request were better in the P than in the NP group [4.9 (3.1?0) mg/dl; 14 (7.9?5.8) ml/min vs. 5.7 (3.1?1.1) mg/dl; 9.7 (5?8.9) ml/min], (p<0.001).] Patients starting (n = 316) with a temporal vascular catheter were progressively switched in the next six weeks to a different access: 49 into an AVF, 36 permanent vascular catheter, 5 with a peritoneal catheter and no grafts use.Table 3. Multivariate logistic regression for planned versus non-planned dialysis start. Pseudo r2 = 0.26. n = 547 Age, years Gender, female vs male eGFR (MDRD 4), > 8.2 ml/min vs. 8.2 ml/min Time from information to initiation of dialysis start, > 2 months vs. 2 months Early referral vs late Diagnosis, Other vs. vascular doi:10.1371/journal.pone.0155987.t003 Odds ratios and 95 CI 1.00 (0.98?.02) 0.84 (0.52?.33) 2.72 (1.72?.27) 4.84 (2.71?.65) 2.12 (1.17?.84) 0.34 (0.19?.60) P 0.97 0.16 0.001 0.001 0.03 0.PLOS ONE | DOI:10.1371/journal.pone.0155987 May 26,7 /Referral, Modality and Dialysis Start in an International SettingTable 4. Characteristics of patients with early referral (>3months) to Integrated Care Settings clinics follow-up according to planning of dialysis start. Population ER to ICS, n ( ) Median CKD follow-up before dialysis start (m.) Median time of predialysis follow-up (m.) Predialysis follow-up, n ( ) Serum creatinine at information (mg/dl) Information on dialysis modalities, n ( ) Information provided consent signing, n ( ) Medical visits during predialysis follow-up, n Hospitalizations during predialysis follow-up, n PD as 1st dialysis session, n ( ) PD as 1st chronic RRT, n ( ) 37 (13) 44 (16) Total 281 (100) 15.1 (3?5) 6.7 (0.3?8) 241 (86) 4.9 (3?0) 241 (86) 144 (51) P 168 (60) 18.1 (5?5) 8.2 (2?5) 156 (93) 4.5 (2.7?1) 160 (95) 88 (52) 8 (2?7) 2 (0?) 34 (20) 34 (20) NP 113 (40) 12 (0.9?3) 4.9 (0?6.4) 85 (75) 6.0 (2.8?3) 81 (72) 56 (49.5) 2 (0?4) 1 (0?) 3 (2.6) 9 (8) P-value 0.001 0.01 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 < 0.001 0.Values are median (10th to 90th percentile), or percentage. Abbreviations: P, planned dialysis start patients; NP, non-planned dialysis start patients; ICS, integrated care setting clinics; CKD, chronic kidney disease; (m.), months; RRT, renal replacement therapy; PD, peritoneal dialysis. doi:10.1371/journal.pone.0155987.tDiscussionIn our multicenter, international experience most patients had medical follow ups since diagnoses of kidney disease. Almost half of the CKD care was provided by nephrologists. However, 49 of patients were referred late to our ICS clinics and 58 started dialysis in a NP manner, without a permanent dialysis access and/or in an emergency.

Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in

Om intestinal epithelial cells, or Dactinomycin web inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- (S)-(-)-Blebbistatin chemical information invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.Om intestinal epithelial cells, or inhibit eukaryotic protein synthesis resulting in intestinal injury[2?]. Pathogenic E. coli that breach the intestinal mucosal barrier are phagocytosed by innate immune cells such as lamina propria macrophages and neutrophils. Some pathogenic E. coli strains have also acquired virulence genes that allow them to avoid destruction within phagocytes and thereby promote disease[6]. For example, uptake of EHEC into macrophages is associated with increased expression of Shiga toxin, and Shiga toxin enhances intra-macrophage survival through an unknown mechanism[6,7]. Likewise, expression of nitric oxide reductase in EHEC enhances their survival within macrophage phagolysosomes presumably by protecting them from reactive nitrogen species [8]. Similar to pathogenic strains of E. coli, resident intestinal (commensal) E. coli also encounter lamina propria macrophages in the intestine, especially during periods of epithelial damage and enhanced mucosal permeability in chronic inflammatory lesions associated with the inflammatory bowel diseases (IBD’s), Crohn’s disease and ulcerative colitis. IBD’s are associated with genetically-determined defective innate immune responses including disordered cytokine secretion and bacterial clearance in macrophages[9,10]. In addition IBD’s and experimental murine colitis are associated with increased numbers of luminal commensal E. coli [11]. Therefore, it is plausible that enhanced survival of E. coli in macrophages may play a role in etiopathogenesis of IBD’s. Indeed, others have shown that resident adherent- invasive E. coli are more prevalent in inflamed ileal tissue from Crohn’s disease patients compared with controls and that a specific adherent-invasive E. coli strain isolated from a human Crohn’s disease patient causes experimental colitis in susceptible hosts in vivo and survives better in macrophages in vitro compared with laboratory reference E. coli strains[12?4]. The increased survival of the adherent-invasive E. coli strain in macrophages is due in part to expression of E. coli htrA, a gene that allows E. coli to grow at elevated temperatures and defend against killing by hydrogen peroxide in vitro[15]. Genes, including htrA, may therefore function as virulence factors in commensal E. coli by protecting the bacteria from toxic reactive oxygen species (ROS) and/or reactive nitrogen species (RNS) found in macrophage phagolysosomes. Similar to HtrA, the E. coli small heat shock proteins IbpA and IbpB also protect bacteria from killing by heat and oxidative stress in laboratory cultures[16?8]. The role of the ibpAB operon in protecting E. coli from heat damage is reinforced by evidence that ibpAB are upregulated in E. coli cultures in response to heat treatment[19,20]. In addition, we have previously shown that a commensal adherent-invasive murine strain of E. coli (NC101), which causes colitis in mono-colonized Il10-/- mice, increases ibpAB expression when present in the inflamed vs. healthy colon, possibly due to the increased concentrations of ROS/RNS in inflamed colon tissue[21?3]. However, it is unknown whether ibpAB are upregulated in response to ROS/RNS are important for the survival of non-pathogenic E. coli in macrophage phagolysosomes. We hypothesized that commensal E. coli upregulate ibpAB in response to ROS and that ibpAB protect E. coli from ROS-mediated killing within macrophages.PLOS ONE | DOI:10.1371/journal.pone.0120249 March 23,2 /IbpAB Protect Comme.

M test. We then performed a multivariate logistic regression analysis to

M test. We then performed a multivariate logistic regression AG-490 molecular weight analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 order VER-52296 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.M test. We then performed a multivariate logistic regression analysis to examine the prediction performance of the clinical response with other clinical variables such as patient age, debulking status, and tumor stage. We also performed Cox proportional hazard regression analyses to understand the prediction performance for patient variable survival times by the three drugs’ predictors together with other important clinical variables.Results Final Drug Biomarkers and PredictorsThe final predictor for paclitaxel was comprised of 20 biomarkers with an AUC of 0.766 for 107 patients treated with the drug in the Bonome-185 cohort (P,0.01). The predictor for cyclophosphamide consisted of 44 genes with an AUC of 0.664 for 68 cyclophosphamide-treated patients also in the Bonome-185 cohort (P = 0.024). As for topotecan, the final predictor included 58 genes with an AUC of 0.917 for 10 patients treated with topotecan in the TCGA-UW cohort (P = 0.143); the Topotecan predictor was not statistically significant due to the small sample size of this cohort despite a very high AUC value (see Results S1 and Figure S1 for the detailed gene lists and the ROC analyses).Predictor Evaluation with Independent EOC CohortsWe examined the prediction performance of the above predictors on independent patient sets that were not used for our biomarker discovery and model training. We first examined the stratification performance of paclitaxel predictor scores between patients with CR and NR for two independent cohorts, TCGA-448 and UVA-51, for short-term clinical response to the primary chemotherapy with paclitaxel; note that clinical response information was available only for paclitaxel, since it was used in the primary platinum-based combination chemotherapy for most EOC patients. In our univariate logistic regression analysis for each of the predictors and clinical variables, a highly significant difference was found between the two patient groups in TCGA448 (p-value = 0.003). For the UVA-51 cohort, paclitaxel predictor scores showed a marginally significant difference between 28 CR and 23 NR patients due to its relatively small sample size (pvalue = 0.075, left column in Table 2). As widely recognized, we also found that optimal vs. suboptimal debulking status was significantly associated with therapeutic response to the primary chemotherapy treatments. Adjusting for the effects of surgical outcome, age, and tumor stage, multivariate logistic regression analysis also showed that patients with higher predictor scores and optimal debulking had significantly higher chances of therapeutic response (predictor odds ratio [OR] = 3.591; 95 CI: 1.494?.85; P = 0.005, right column in Table 2). Therefore, the predictor showed predictive information beyond patient debulking status in this multivariate analysis. For the UVA-51 cohort, the paclitaxel predictor again showed a marginally significant association with drug response (predictor OR = 9.521; 95 CI: 0.99?25.73, P = 0.063). We next examined the prediction performance of the three drug predictors and clinical variables for long-term survival of thedoi:10.1371/journal.pone.0086532.tclinical response and survival data of EOC patients to obtain the best therapeutic predictor for each drug. For this evaluation of competing models, we used the Bonome-185 set for paclitaxel and cyclophosphamide and the TCGA-UW set for topotecan. The Bonome-185 and the TGGA-UW sets also used to pre-define predicted responders (CR) and non-r.

[PubMed: 21367916] Mount PF, Power DA. Nitric oxide in the kidney: functions

[Pemafibrate clinical trials PubMed: 21367916] Mount PF, Power DA. Nitric oxide in the kidney: functions and regulation of synthesis. Acta Physiol (Oxf). 2006; 187:433?6. [PubMed: 16866775] Najafian B, Alpers CE, Fogo AB. Pathology of human diabetic nephropathy. Contributions to nephrology. 2011; 170:36?7. [PubMed: 21659756] Nakagawa T, Sato W, Glushakova O, Heinig M, Clarke T, Campbell-Thompson M, et al. Diabetic endothelial nitric oxide synthase knockout mice develop advanced diabetic nephropathy. J Am Soc Nephrol. 2007; 18:539?0. [PubMed: 17202420] Neugarten J, Ding Q, Friedman A, Lei J, Silbiger S. Sex hormones and renal nitric oxide synthases. Journal of the American Society of Nephrology: JASN. 1997; 8:1240?. [PubMed: 9259350]Author Manuscript Author Manuscript Author Manuscript Author ManuscriptActa Histochem. Author manuscript; available in PMC 2017 March 01.Slyvka et al.PageNeugarten J, Silbiger SR. Effects of sex hormones on mesangial cells. American journal of kidney diseases: the official journal of the National Kidney Foundation. 1995; 26:147?1. [PubMed: 7611246] Pfeilschifter J, Eberhardt W, Beck KF. Regulation of gene expression by nitric oxide. Pflugers Archiv: European journal of physiology. 2001; 442:479?6. [PubMed: 11510878] Pfeilschifter J, Eberhardt W, Beck KF, Huwiler A. Redox signaling in mesangial cells. Nephron Experimental nephrology. 2003; 93:e23?. [PubMed: 12411746] Phillips AO, Steadman R. Diabetic nephropathy: the central role of renal proximal tubular cells in tubulointerstitial injury. Histology and histopathology. 2002; 17:247?2. [PubMed: 11813875] Prabhakar S, Starnes J, Shi S, Lonis B, Tran R. Diabetic nephropathy is associated with oxidative stress and decreased renal nitric oxide production. J Am Soc Nephrol. 2007; 18:2945?2. [PubMed: 17928507] Ptilovanciv EO, Fernandes GS, Teixeira LC, Reis LA, Pessoa EA, Convento MB, et al. Heme oxygenase 1 improves glucoses metabolism and kidney histological alterations in diabetic rats. Diabetology metabolic syndrome. 2013; 5:3. [PubMed: 23321053] Raij L, Baylis C. Glomerular actions of nitric oxide. Kidney International. 1995; 48:20?2. [PubMed: 7564080] Raij L, Shultz PJ. Endothelium-derived relaxing factor, nitric oxide: effects on and production by mesangial cells and the glomerulus. J Am Soc Nephrol. 1993; 3:1435?1. [PubMed: 8387828] Romagnani P, Pupilli C, Lasagni L, Baccari MC, Bellini F, Amorosi A, et al. Inducible nitric oxide synthase expression in vascular and glomerular structures of human chronic allograft nephropathy. J Pathol. 1999; 187:345?0. [PubMed: 10398090] get (R)-K-13675 Rupprecht HD, Akagi Y, Keil A, Hofer G. Nitric oxide inhibits growth of glomerular mesangial cells: role of the transcription factor EGR-1. Kidney Int. 2000; 57:70?2. [PubMed: 10620189] Schena FP, Gesualdo L. Pathogenetic mechanisms of diabetic nephropathy. J Am Soc Nephrol. 2005; 16(Suppl 1):S30?. [PubMed: 15938030] Sego S. Pathophysiology of diabetic nephropathy. Nephrol Nurs J. 2007; 34:631?. [PubMed: 18203571] Shin SJ, Lai FJ, Wen JD, Hsiao PJ, Hsieh MC, Tzeng TF, et al. Neuronal and endothelial nitric oxide synthase expression in outer medulla of streptozotocin-induced diabetic rat kidney. Diabetologia. 2000; 43:649?9. [PubMed: 10855540] Slyvka Y, Inman SR, Malgor R, Jackson EJ, Yee J, Oshogwemoh O, et al. Protective effects of antioxidant fortified diet on renal function and metabolic profile in obese Zucker rat. Endocrine. 2009; 39:89?00. [PubMed: 19051067] Slyvka Y, Wang Z, Yee J, Inman SR, Nowak FV. Antioxi.[PubMed: 21367916] Mount PF, Power DA. Nitric oxide in the kidney: functions and regulation of synthesis. Acta Physiol (Oxf). 2006; 187:433?6. [PubMed: 16866775] Najafian B, Alpers CE, Fogo AB. Pathology of human diabetic nephropathy. Contributions to nephrology. 2011; 170:36?7. [PubMed: 21659756] Nakagawa T, Sato W, Glushakova O, Heinig M, Clarke T, Campbell-Thompson M, et al. Diabetic endothelial nitric oxide synthase knockout mice develop advanced diabetic nephropathy. J Am Soc Nephrol. 2007; 18:539?0. [PubMed: 17202420] Neugarten J, Ding Q, Friedman A, Lei J, Silbiger S. Sex hormones and renal nitric oxide synthases. Journal of the American Society of Nephrology: JASN. 1997; 8:1240?. [PubMed: 9259350]Author Manuscript Author Manuscript Author Manuscript Author ManuscriptActa Histochem. Author manuscript; available in PMC 2017 March 01.Slyvka et al.PageNeugarten J, Silbiger SR. Effects of sex hormones on mesangial cells. American journal of kidney diseases: the official journal of the National Kidney Foundation. 1995; 26:147?1. [PubMed: 7611246] Pfeilschifter J, Eberhardt W, Beck KF. Regulation of gene expression by nitric oxide. Pflugers Archiv: European journal of physiology. 2001; 442:479?6. [PubMed: 11510878] Pfeilschifter J, Eberhardt W, Beck KF, Huwiler A. Redox signaling in mesangial cells. Nephron Experimental nephrology. 2003; 93:e23?. [PubMed: 12411746] Phillips AO, Steadman R. Diabetic nephropathy: the central role of renal proximal tubular cells in tubulointerstitial injury. Histology and histopathology. 2002; 17:247?2. [PubMed: 11813875] Prabhakar S, Starnes J, Shi S, Lonis B, Tran R. Diabetic nephropathy is associated with oxidative stress and decreased renal nitric oxide production. J Am Soc Nephrol. 2007; 18:2945?2. [PubMed: 17928507] Ptilovanciv EO, Fernandes GS, Teixeira LC, Reis LA, Pessoa EA, Convento MB, et al. Heme oxygenase 1 improves glucoses metabolism and kidney histological alterations in diabetic rats. Diabetology metabolic syndrome. 2013; 5:3. [PubMed: 23321053] Raij L, Baylis C. Glomerular actions of nitric oxide. Kidney International. 1995; 48:20?2. [PubMed: 7564080] Raij L, Shultz PJ. Endothelium-derived relaxing factor, nitric oxide: effects on and production by mesangial cells and the glomerulus. J Am Soc Nephrol. 1993; 3:1435?1. [PubMed: 8387828] Romagnani P, Pupilli C, Lasagni L, Baccari MC, Bellini F, Amorosi A, et al. Inducible nitric oxide synthase expression in vascular and glomerular structures of human chronic allograft nephropathy. J Pathol. 1999; 187:345?0. [PubMed: 10398090] Rupprecht HD, Akagi Y, Keil A, Hofer G. Nitric oxide inhibits growth of glomerular mesangial cells: role of the transcription factor EGR-1. Kidney Int. 2000; 57:70?2. [PubMed: 10620189] Schena FP, Gesualdo L. Pathogenetic mechanisms of diabetic nephropathy. J Am Soc Nephrol. 2005; 16(Suppl 1):S30?. [PubMed: 15938030] Sego S. Pathophysiology of diabetic nephropathy. Nephrol Nurs J. 2007; 34:631?. [PubMed: 18203571] Shin SJ, Lai FJ, Wen JD, Hsiao PJ, Hsieh MC, Tzeng TF, et al. Neuronal and endothelial nitric oxide synthase expression in outer medulla of streptozotocin-induced diabetic rat kidney. Diabetologia. 2000; 43:649?9. [PubMed: 10855540] Slyvka Y, Inman SR, Malgor R, Jackson EJ, Yee J, Oshogwemoh O, et al. Protective effects of antioxidant fortified diet on renal function and metabolic profile in obese Zucker rat. Endocrine. 2009; 39:89?00. [PubMed: 19051067] Slyvka Y, Wang Z, Yee J, Inman SR, Nowak FV. Antioxi.

G paclitaxel-induced mitotic arrest, Bcl-2 was phosphorylated and more tightly bound

G paclitaxel-induced mitotic arrest, Bcl-2 was phosphorylated and more tightly bound to Bak and Bim. Collectively, these results suggest that phosphorylation of the Bcl-2 FLD leads to a conformational change in the “Bcl-2 core” that affects binding of pro-apoptotic proteins to the BH3 binding groove.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptBiochim Biophys Acta. Author manuscript; available in PMC 2016 July 01.Correia et al.PageInterpretation of these results would have been enhanced by structural information about the impact of FLD alterations on overall Bcl-2 conformation. Unfortunately, all published Bcl-2 structures either lack the FLD or replace it with the corresponding region of Bcl-xL [148, 149]. Phosphorylation also modulates the function of other anti-apoptotic Bcl-2 family members. Bcl-xL is phosphorylated on T47 and S62 [150]. Phosphorylation of the latter site by JNK decreases binding of Bcl-xL to Bax, thus diminishing Bcl-xL anti-apoptotic function [151]. Likewise, Mcl-1 phosphorylation at S159 by glycogen synthase kinase-3 (GSK-3) diminishes Mcl-1 anti-apoptotic function, in this case by enhancing Mcl-1 binding to the LCZ696MedChemExpress LCZ696 ubiquitin E3 ligase TrCP [152] and subsequent turnover [153]. In contrast, CDK- and JNKmediated Mcl-1 phosphorylation at S64 increases Mcl-1 binding to Noxa, Bak and Bim, thereby potentiating its anti-apoptotic activity [154]. Because phosphorylation of Bcl-2 (on its FLD) and Mcl-1 (at S64) increases the anti-apoptotic effects of these proteins, it has been suggested that these phosphorylations might contribute to chemoresistance [155?57].Author Manuscript Author Manuscript Author Manuscript Author Manuscript3. BCL2 sequence variation3.1. BCL2 sequence variation in clinical lymphomas As indicated above, BCL2 translocation to the IGH locus contributes to high level Bcl-2 expression in 90 of FLs and 20 of de novo diffuse large B-cell lymphomas (DLBCLs), mostly of the germinal center B-cell subtype (GCB-DLBCL) [158]. Some of these lymphomas also contain BCL2 mutations. Single nucleotide variants (SNVs), including some that cause amino acid substitutions and others that are silent, were demonstrated soon after BCL2 was cloned [159, 160]. Detection of similar SNVs in untreated FL ruled out chemotherapy as a cause of these BCL2 Procyanidin B1 site mutations [159]. In contrast to the impact of other abnormalities involving BCL2, e.g., the extremely poor prognosis of so-called “double hit” lymphomas that harbor translocations involving both the MYC and BCL2 genes [161], the effects of BCL2 SNVs on DLBCL and FL have been less clear. Recent sequencing of large numbers of primary DLBCL samples and matched germline DNA has demonstrated a high incidence of tumor-associated BCL2 mutations and linked these changes to somatic hypermutation, an activation-induced cytidine deaminase- (AID-) driven mutagenic process that ordinarily generates antibody diversity [162?65]. Because most BCL2 mutations in DLBCL (60?0 ) are synonymous [162] and not associated with any impact on chemosensitivity or survival [165], it has been assumed that BCL2 mutations in DLBCL are passenger mutations. Additional studies have examined BCL2 mutations in FL. More indolent than DLBCL, FL nonetheless carries a 2? /year risk of transformation to a more aggressive neoplasm. Transformed FL (tFL) most often resembles DLBCL morphologically [166, 167] but historically has been quite resistant to therapy [167, 168]. This poor therapeutic response of.G paclitaxel-induced mitotic arrest, Bcl-2 was phosphorylated and more tightly bound to Bak and Bim. Collectively, these results suggest that phosphorylation of the Bcl-2 FLD leads to a conformational change in the “Bcl-2 core” that affects binding of pro-apoptotic proteins to the BH3 binding groove.Author Manuscript Author Manuscript Author Manuscript Author ManuscriptBiochim Biophys Acta. Author manuscript; available in PMC 2016 July 01.Correia et al.PageInterpretation of these results would have been enhanced by structural information about the impact of FLD alterations on overall Bcl-2 conformation. Unfortunately, all published Bcl-2 structures either lack the FLD or replace it with the corresponding region of Bcl-xL [148, 149]. Phosphorylation also modulates the function of other anti-apoptotic Bcl-2 family members. Bcl-xL is phosphorylated on T47 and S62 [150]. Phosphorylation of the latter site by JNK decreases binding of Bcl-xL to Bax, thus diminishing Bcl-xL anti-apoptotic function [151]. Likewise, Mcl-1 phosphorylation at S159 by glycogen synthase kinase-3 (GSK-3) diminishes Mcl-1 anti-apoptotic function, in this case by enhancing Mcl-1 binding to the ubiquitin E3 ligase TrCP [152] and subsequent turnover [153]. In contrast, CDK- and JNKmediated Mcl-1 phosphorylation at S64 increases Mcl-1 binding to Noxa, Bak and Bim, thereby potentiating its anti-apoptotic activity [154]. Because phosphorylation of Bcl-2 (on its FLD) and Mcl-1 (at S64) increases the anti-apoptotic effects of these proteins, it has been suggested that these phosphorylations might contribute to chemoresistance [155?57].Author Manuscript Author Manuscript Author Manuscript Author Manuscript3. BCL2 sequence variation3.1. BCL2 sequence variation in clinical lymphomas As indicated above, BCL2 translocation to the IGH locus contributes to high level Bcl-2 expression in 90 of FLs and 20 of de novo diffuse large B-cell lymphomas (DLBCLs), mostly of the germinal center B-cell subtype (GCB-DLBCL) [158]. Some of these lymphomas also contain BCL2 mutations. Single nucleotide variants (SNVs), including some that cause amino acid substitutions and others that are silent, were demonstrated soon after BCL2 was cloned [159, 160]. Detection of similar SNVs in untreated FL ruled out chemotherapy as a cause of these BCL2 mutations [159]. In contrast to the impact of other abnormalities involving BCL2, e.g., the extremely poor prognosis of so-called “double hit” lymphomas that harbor translocations involving both the MYC and BCL2 genes [161], the effects of BCL2 SNVs on DLBCL and FL have been less clear. Recent sequencing of large numbers of primary DLBCL samples and matched germline DNA has demonstrated a high incidence of tumor-associated BCL2 mutations and linked these changes to somatic hypermutation, an activation-induced cytidine deaminase- (AID-) driven mutagenic process that ordinarily generates antibody diversity [162?65]. Because most BCL2 mutations in DLBCL (60?0 ) are synonymous [162] and not associated with any impact on chemosensitivity or survival [165], it has been assumed that BCL2 mutations in DLBCL are passenger mutations. Additional studies have examined BCL2 mutations in FL. More indolent than DLBCL, FL nonetheless carries a 2? /year risk of transformation to a more aggressive neoplasm. Transformed FL (tFL) most often resembles DLBCL morphologically [166, 167] but historically has been quite resistant to therapy [167, 168]. This poor therapeutic response of.

Iological Characteristics in Habitats of High and Low Presence of Anopheline

Iological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Western Kenya HighlandsBryson A. Ndenga1,2*, Jemimah A. Simbauni1, Jenard P. Mbugi1, Andrew K. Githeko1 Department of Zoological Sciences, Kenyatta University, Nairobi, Kenya, 2 Centre for Global Health Research, Kenya Medical Research Institute, Kisumu, KenyaAbstractBackground: Characteristics of aquatic habitats determine whether mosquitoes will oviposit, hatch, develop, pupate and successfully emerge into adults or not, thus influencing which mosquito species will occupy a habitat. This study determined whether physiochemical and biological characteristics differ between habitats with high and low presence of anopheline larvae. Methods: Physical, chemical and biological characteristics were evaluated in selected habitats twice per month SKF-96365 (hydrochloride) price within three highland valleys in western Kenya. Aquatic macro-organisms were sampled using a sweep-net. Colorimetric methods were used to determine levels of iron, phosphate, nitrate, ammonium and nitrite in water samples. Generalized Estimating Equations (GEE) was used to compare parameters between the two categories of anopheline presence. Results: Habitats with high anopheline presence had greater abundance of mosquito aquatic stages and tadpoles and two times more levels of nitrate in water, whereas habitats with low anopheline presence had wider biofilm cover and higher levels of iron in water. Conclusion: Habitats of high and low presence of anopheline larvae, which differed in a number of physical, chemical and biological characteristics, were identified in valleys within western Kenya highlands. Differences in habitat characteristics are critical in determining the number of anopheline larvae that will fully develop and emerge into adults.Citation: Ndenga BA, Simbauni JA, Mbugi JP, Githeko AK (2012) Physical, Chemical and Biological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Western Kenya Highlands. PLoS ONE 7(10): e47975. doi:10.1371/journal.pone.0047975 Editor: Olle Terenius, Swedish University of Agricultural Sciences, Sweden Received May 28, 2012; Accepted September 19, 2012; Published October 23, 2012 Copyright: ?2012 Ndenga et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was funded by the World Health Organization (WHO) Special Programme for Research and Training in Tropical Diseases (TDR)-Research Training Grant (RTG) and Valent BioSciences Corporation. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: This research study received part of its funding from a commercial source “Valent BioSciences Corporation”. The authors declare that they have no competing interest relating to employment, consultancy, patents, and products in development or on the market. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. * E-mail: [email protected] habitats are an important component of the process that results in Pamapimod clinical trials malaria transmission. Mosquito life cycle processes including oviposition, larval development, pupation and emergence occur in aquatic habitats. These habitats are crucial in determining the types of.Iological Characteristics in Habitats of High and Low Presence of Anopheline Larvae in Western Kenya HighlandsBryson A. Ndenga1,2*, Jemimah A. Simbauni1, Jenard P. Mbugi1, Andrew K. Githeko1 Department of Zoological Sciences, Kenyatta University, Nairobi, Kenya, 2 Centre for Global Health Research, Kenya Medical Research Institute, Kisumu, KenyaAbstractBackground: Characteristics of aquatic habitats determine whether mosquitoes will oviposit, hatch, develop, pupate and successfully emerge into adults or not, thus influencing which mosquito species will occupy a habitat. This study determined whether physiochemical and biological characteristics differ between habitats with high and low presence of anopheline larvae. Methods: Physical, chemical and biological characteristics were evaluated in selected habitats twice per month within three highland valleys in western Kenya. Aquatic macro-organisms were sampled using a sweep-net. Colorimetric methods were used to determine levels of iron, phosphate, nitrate, ammonium and nitrite in water samples. Generalized Estimating Equations (GEE) was used to compare parameters between the two categories of anopheline presence. Results: Habitats with high anopheline presence had greater abundance of mosquito aquatic stages and tadpoles and two times more levels of nitrate in water, whereas habitats with low anopheline presence had wider biofilm cover and higher levels of iron in water. Conclusion: Habitats of high and low presence of anopheline larvae, which differed in a number of physical, chemical and biological characteristics, were identified in valleys within western Kenya highlands. Differences in habitat characteristics are critical in determining the number of anopheline larvae that will fully develop and emerge into adults.Citation: Ndenga BA, Simbauni JA, Mbugi JP, Githeko AK (2012) Physical, Chemical and Biological Characteristics in Habitats of High and Low Presen